FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627699_at:

>probe:Drosophila_2:1627699_at:506:563; Interrogation_Position=226; Antisense; GGAAGAGTTATCCACCGGCTGTTCT
>probe:Drosophila_2:1627699_at:17:573; Interrogation_Position=242; Antisense; GGCTGTTCTTCTCGATATGGACCAT
>probe:Drosophila_2:1627699_at:273:129; Interrogation_Position=262; Antisense; ACCATGTTCTTTTATTTCCTCTTCA
>probe:Drosophila_2:1627699_at:519:199; Interrogation_Position=286; Antisense; AACGACAGCTTGGATGTGGGCTCCC
>probe:Drosophila_2:1627699_at:280:621; Interrogation_Position=311; Antisense; TGCTGCTGCTAATGGCGGCCAAAAT
>probe:Drosophila_2:1627699_at:142:211; Interrogation_Position=396; Antisense; AAGACTCTGTCTGTCCAGTTTGTAC
>probe:Drosophila_2:1627699_at:9:729; Interrogation_Position=442; Antisense; TTGGAGACCCTTTTCAGCATCGTTT
>probe:Drosophila_2:1627699_at:583:343; Interrogation_Position=458; Antisense; GCATCGTTTCATTTGGTCTTTTGGT
>probe:Drosophila_2:1627699_at:560:727; Interrogation_Position=489; Antisense; TTGGCTTGGCTTTCATTGCAAACTG
>probe:Drosophila_2:1627699_at:445:177; Interrogation_Position=508; Antisense; AAACTGTTTGCCTATCTGACGGTGA
>probe:Drosophila_2:1627699_at:203:465; Interrogation_Position=531; Antisense; GATTGCCCTACTATATCACGATGTG
>probe:Drosophila_2:1627699_at:253:333; Interrogation_Position=584; Antisense; GCTGGAACGATACTCTGCTGTCGAT
>probe:Drosophila_2:1627699_at:296:619; Interrogation_Position=599; Antisense; TGCTGTCGATACAATACTTCTCCCT
>probe:Drosophila_2:1627699_at:394:713; Interrogation_Position=616; Antisense; TTCTCCCTGCTGTTCTGCAAAATTG

Paste this into a BLAST search page for me
GGAAGAGTTATCCACCGGCTGTTCTGGCTGTTCTTCTCGATATGGACCATACCATGTTCTTTTATTTCCTCTTCAAACGACAGCTTGGATGTGGGCTCCCTGCTGCTGCTAATGGCGGCCAAAATAAGACTCTGTCTGTCCAGTTTGTACTTGGAGACCCTTTTCAGCATCGTTTGCATCGTTTCATTTGGTCTTTTGGTTTGGCTTGGCTTTCATTGCAAACTGAAACTGTTTGCCTATCTGACGGTGAGATTGCCCTACTATATCACGATGTGGCTGGAACGATACTCTGCTGTCGATTGCTGTCGATACAATACTTCTCCCTTTCTCCCTGCTGTTCTGCAAAATTG

Full Affymetrix probeset data:

Annotations for 1627699_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720