Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627700_at:

>probe:Drosophila_2:1627700_at:498:407; Interrogation_Position=2882; Antisense; GACGGCGCATAGTTTCGGATCACTG
>probe:Drosophila_2:1627700_at:572:451; Interrogation_Position=2899; Antisense; GATCACTGAAACTGAGCCGGTCCTC
>probe:Drosophila_2:1627700_at:86:583; Interrogation_Position=2978; Antisense; TGGCTCCGGTGTCAGCAGCTTCGAT
>probe:Drosophila_2:1627700_at:701:449; Interrogation_Position=3000; Antisense; GATCCCATGCAGCTTATCGGAACTC
>probe:Drosophila_2:1627700_at:507:479; Interrogation_Position=3037; Antisense; GTTTCGATGAGTGCCCACTGCTGGA
>probe:Drosophila_2:1627700_at:388:587; Interrogation_Position=3058; Antisense; TGGAGCCGCTGGTCTGCAAGAAGAT
>probe:Drosophila_2:1627700_at:281:211; Interrogation_Position=3075; Antisense; AAGAAGATCGCCCACGAGCGGCTGA
>probe:Drosophila_2:1627700_at:365:611; Interrogation_Position=3097; Antisense; TGACGGCGCTGATCTTTCGCGAGGA
>probe:Drosophila_2:1627700_at:477:407; Interrogation_Position=3131; Antisense; GACGGCGTGCCAGGATGGATTCATC
>probe:Drosophila_2:1627700_at:417:441; Interrogation_Position=3144; Antisense; GATGGATTCATCTACACCTGGGCGC
>probe:Drosophila_2:1627700_at:282:647; Interrogation_Position=3176; Antisense; TCATGCCACGCGTAATCTTGTCAAG
>probe:Drosophila_2:1627700_at:535:429; Interrogation_Position=3340; Antisense; GAGTTTATGAACCACACACGACACA
>probe:Drosophila_2:1627700_at:315:357; Interrogation_Position=3359; Antisense; GACACACCGTACACCCGTAATATAT
>probe:Drosophila_2:1627700_at:312:687; Interrogation_Position=3446; Antisense; TATACGCAGCATCATCAGGCAACAG

Paste this into a BLAST search page for me
GACGGCGCATAGTTTCGGATCACTGGATCACTGAAACTGAGCCGGTCCTCTGGCTCCGGTGTCAGCAGCTTCGATGATCCCATGCAGCTTATCGGAACTCGTTTCGATGAGTGCCCACTGCTGGATGGAGCCGCTGGTCTGCAAGAAGATAAGAAGATCGCCCACGAGCGGCTGATGACGGCGCTGATCTTTCGCGAGGAGACGGCGTGCCAGGATGGATTCATCGATGGATTCATCTACACCTGGGCGCTCATGCCACGCGTAATCTTGTCAAGGAGTTTATGAACCACACACGACACAGACACACCGTACACCCGTAATATATTATACGCAGCATCATCAGGCAACAG

Full Affymetrix probeset data:

Annotations for 1627700_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime