Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627702_at:

>probe:Drosophila_2:1627702_at:483:639; Interrogation_Position=2631; Antisense; TCGTGGGCCTGCAACATGTGTACAT
>probe:Drosophila_2:1627702_at:96:547; Interrogation_Position=2704; Antisense; GGATCCAGCCGGGTATGATACGCAT
>probe:Drosophila_2:1627702_at:405:605; Interrogation_Position=2719; Antisense; TGATACGCATTGTTCCCAGTGGAGG
>probe:Drosophila_2:1627702_at:59:489; Interrogation_Position=2813; Antisense; GTACGCTCTGCATACATAACCCAAA
>probe:Drosophila_2:1627702_at:636:171; Interrogation_Position=2858; Antisense; AAAGTTCTCTTATCGTGCATGAGCT
>probe:Drosophila_2:1627702_at:335:57; Interrogation_Position=2876; Antisense; ATGAGCTAGCTCCTGACTGTTGTTC
>probe:Drosophila_2:1627702_at:205:611; Interrogation_Position=2889; Antisense; TGACTGTTGTTCTTGCATGCTCGAC
>probe:Drosophila_2:1627702_at:88:271; Interrogation_Position=2904; Antisense; CATGCTCGACTTTGAAACTGTGATA
>probe:Drosophila_2:1627702_at:422:485; Interrogation_Position=2941; Antisense; GTAGGCGGCAGGTTCATTATCCACT
>probe:Drosophila_2:1627702_at:621:143; Interrogation_Position=2963; Antisense; ACTGCATGGCTCCACCTGAAAGACA
>probe:Drosophila_2:1627702_at:542:197; Interrogation_Position=3017; Antisense; AACGAATTGCTTAAGCGCGGCCTTT
>probe:Drosophila_2:1627702_at:417:151; Interrogation_Position=3076; Antisense; ACATTAAATGCAATCGCCTCAGCCT
>probe:Drosophila_2:1627702_at:76:261; Interrogation_Position=3095; Antisense; CAGCCTCAGGCCGTTTAATTTAACA
>probe:Drosophila_2:1627702_at:198:229; Interrogation_Position=3161; Antisense; CAGAGTTTATTATTTTTAGCCCGCT

Paste this into a BLAST search page for me
TCGTGGGCCTGCAACATGTGTACATGGATCCAGCCGGGTATGATACGCATTGATACGCATTGTTCCCAGTGGAGGGTACGCTCTGCATACATAACCCAAAAAAGTTCTCTTATCGTGCATGAGCTATGAGCTAGCTCCTGACTGTTGTTCTGACTGTTGTTCTTGCATGCTCGACCATGCTCGACTTTGAAACTGTGATAGTAGGCGGCAGGTTCATTATCCACTACTGCATGGCTCCACCTGAAAGACAAACGAATTGCTTAAGCGCGGCCTTTACATTAAATGCAATCGCCTCAGCCTCAGCCTCAGGCCGTTTAATTTAACACAGAGTTTATTATTTTTAGCCCGCT

Full Affymetrix probeset data:

Annotations for 1627702_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime