FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627703_at:

>probe:Drosophila_2:1627703_at:154:279; Interrogation_Position=135; Antisense; CTATGTGTCGCACCGCATCTACAAG
>probe:Drosophila_2:1627703_at:706:625; Interrogation_Position=194; Antisense; TGCCGATGCACATCCAGCTGAAGGT
>probe:Drosophila_2:1627703_at:13:119; Interrogation_Position=209; Antisense; AGCTGAAGGTGCGAACCCGGGCCAC
>probe:Drosophila_2:1627703_at:596:127; Interrogation_Position=232; Antisense; ACCAACGGGCTGATCATGCTGGCGG
>probe:Drosophila_2:1627703_at:683:565; Interrogation_Position=265; Antisense; GGCACCAAGGGTGGCCACTACATGG
>probe:Drosophila_2:1627703_at:410:665; Interrogation_Position=283; Antisense; TACATGGCCCTTTTCCTGCAGAAGG
>probe:Drosophila_2:1627703_at:51:221; Interrogation_Position=304; Antisense; AAGGGACTCATGCAGTTCCAGTTCT
>probe:Drosophila_2:1627703_at:197:501; Interrogation_Position=31; Antisense; GTCGATGCCGCGCAGAGGCAAAAAT
>probe:Drosophila_2:1627703_at:100:93; Interrogation_Position=323; Antisense; AGTTCTCCTGCGGACTGCAGACGAT
>probe:Drosophila_2:1627703_at:295:409; Interrogation_Position=342; Antisense; GACGATGCTGCTGAGTGAACTGGAA
>probe:Drosophila_2:1627703_at:605:509; Interrogation_Position=356; Antisense; GTGAACTGGAAACGCCGGTCAACAC
>probe:Drosophila_2:1627703_at:112:59; Interrogation_Position=54; Antisense; ATGTGTTTGTCGTTTCGACCGCCAA
>probe:Drosophila_2:1627703_at:174:225; Interrogation_Position=77; Antisense; AAGGACCTCTTTGCGAGCTGCCCAT
>probe:Drosophila_2:1627703_at:289:419; Interrogation_Position=91; Antisense; GAGCTGCCCATTATCATCCGGAATG

Paste this into a BLAST search page for me
CTATGTGTCGCACCGCATCTACAAGTGCCGATGCACATCCAGCTGAAGGTAGCTGAAGGTGCGAACCCGGGCCACACCAACGGGCTGATCATGCTGGCGGGGCACCAAGGGTGGCCACTACATGGTACATGGCCCTTTTCCTGCAGAAGGAAGGGACTCATGCAGTTCCAGTTCTGTCGATGCCGCGCAGAGGCAAAAATAGTTCTCCTGCGGACTGCAGACGATGACGATGCTGCTGAGTGAACTGGAAGTGAACTGGAAACGCCGGTCAACACATGTGTTTGTCGTTTCGACCGCCAAAAGGACCTCTTTGCGAGCTGCCCATGAGCTGCCCATTATCATCCGGAATG

Full Affymetrix probeset data:

Annotations for 1627703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720