FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627707_at:

>probe:Drosophila_2:1627707_at:632:371; Interrogation_Position=1321; Antisense; GAAGGTAACCTGCTCACCGTTGGCA
>probe:Drosophila_2:1627707_at:196:497; Interrogation_Position=1349; Antisense; GTCTGGGCATGCTCCTATTCTACGA
>probe:Drosophila_2:1627707_at:243:689; Interrogation_Position=1364; Antisense; TATTCTACGACATTCGAGCCGGAAA
>probe:Drosophila_2:1627707_at:673:101; Interrogation_Position=1397; Antisense; AGAGCAGTGTGAATGCCTCGCGCAC
>probe:Drosophila_2:1627707_at:681:79; Interrogation_Position=1484; Antisense; AGGTGAAGTATGTGCCCGCCATCTA
>probe:Drosophila_2:1627707_at:232:39; Interrogation_Position=1504; Antisense; ATCTACACCCACTGCTATGACAGCA
>probe:Drosophila_2:1627707_at:576:55; Interrogation_Position=1520; Antisense; ATGACAGCACTAGGATGCGCCTCTT
>probe:Drosophila_2:1627707_at:14:75; Interrogation_Position=1551; Antisense; AGGAGGACCACTGCCGGCGACTTTG
>probe:Drosophila_2:1627707_at:217:277; Interrogation_Position=1565; Antisense; CGGCGACTTTGGTGGGCAACTATGC
>probe:Drosophila_2:1627707_at:358:191; Interrogation_Position=1582; Antisense; AACTATGCGGGCGTTTGGCAATAGA
>probe:Drosophila_2:1627707_at:517:25; Interrogation_Position=1602; Antisense; ATAGATTGGCATAGGATCCGATCCG
>probe:Drosophila_2:1627707_at:265:449; Interrogation_Position=1621; Antisense; GATCCGGGCTCACAATACTGATTAG
>probe:Drosophila_2:1627707_at:485:451; Interrogation_Position=1670; Antisense; GATCTTTAATCTTTTGGCGCATTTC
>probe:Drosophila_2:1627707_at:134:43; Interrogation_Position=1702; Antisense; ATCGTTCACCTGCATATGTATTCCG

Paste this into a BLAST search page for me
GAAGGTAACCTGCTCACCGTTGGCAGTCTGGGCATGCTCCTATTCTACGATATTCTACGACATTCGAGCCGGAAAAGAGCAGTGTGAATGCCTCGCGCACAGGTGAAGTATGTGCCCGCCATCTAATCTACACCCACTGCTATGACAGCAATGACAGCACTAGGATGCGCCTCTTAGGAGGACCACTGCCGGCGACTTTGCGGCGACTTTGGTGGGCAACTATGCAACTATGCGGGCGTTTGGCAATAGAATAGATTGGCATAGGATCCGATCCGGATCCGGGCTCACAATACTGATTAGGATCTTTAATCTTTTGGCGCATTTCATCGTTCACCTGCATATGTATTCCG

Full Affymetrix probeset data:

Annotations for 1627707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720