FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627709_at:

>probe:Drosophila_2:1627709_at:367:521; Interrogation_Position=1043; Antisense; GTGGCCCAGTCATTCTGCGGAAGTC
>probe:Drosophila_2:1627709_at:436:219; Interrogation_Position=1063; Antisense; AAGTCCAGGCAGTTCTTGGTCGGAA
>probe:Drosophila_2:1627709_at:241:729; Interrogation_Position=1078; Antisense; TTGGTCGGAATCATCAGCTACGGAA
>probe:Drosophila_2:1627709_at:30:121; Interrogation_Position=1105; Antisense; AGCTGTGCTGAATCGCAGTACCCGA
>probe:Drosophila_2:1627709_at:122:391; Interrogation_Position=1184; Antisense; GAAACTCCAATTGTGTTGTCAGCTT
>probe:Drosophila_2:1627709_at:488:609; Interrogation_Position=711; Antisense; TGAGCAGTATGTTAGCGACCCCGAC
>probe:Drosophila_2:1627709_at:366:43; Interrogation_Position=748; Antisense; ATCGCAGTTTTGATAACCGCCAGCA
>probe:Drosophila_2:1627709_at:663:263; Interrogation_Position=768; Antisense; CAGCAATATTCAGTGGTCCCGAGGC
>probe:Drosophila_2:1627709_at:729:19; Interrogation_Position=802; Antisense; ATTTGTCTGCCTCCCGTAGGAACGA
>probe:Drosophila_2:1627709_at:133:137; Interrogation_Position=842; Antisense; ACGACCTCGTCGACGTGATTGGCTA
>probe:Drosophila_2:1627709_at:286:465; Interrogation_Position=858; Antisense; GATTGGCTATGGCACGGTCTTCTTT
>probe:Drosophila_2:1627709_at:49:311; Interrogation_Position=890; Antisense; CCACGTCCACAAGTCTGCAGAAGAT
>probe:Drosophila_2:1627709_at:634:63; Interrogation_Position=962; Antisense; ATGTGGCCACGATATACACTGGGCA
>probe:Drosophila_2:1627709_at:362:229; Interrogation_Position=987; Antisense; AATGTGCACCTATGACTACTCGGGC

Paste this into a BLAST search page for me
GTGGCCCAGTCATTCTGCGGAAGTCAAGTCCAGGCAGTTCTTGGTCGGAATTGGTCGGAATCATCAGCTACGGAAAGCTGTGCTGAATCGCAGTACCCGAGAAACTCCAATTGTGTTGTCAGCTTTGAGCAGTATGTTAGCGACCCCGACATCGCAGTTTTGATAACCGCCAGCACAGCAATATTCAGTGGTCCCGAGGCATTTGTCTGCCTCCCGTAGGAACGAACGACCTCGTCGACGTGATTGGCTAGATTGGCTATGGCACGGTCTTCTTTCCACGTCCACAAGTCTGCAGAAGATATGTGGCCACGATATACACTGGGCAAATGTGCACCTATGACTACTCGGGC

Full Affymetrix probeset data:

Annotations for 1627709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720