FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627711_at:

>probe:Drosophila_2:1627711_at:134:327; Interrogation_Position=1772; Antisense; GCGATTGTTTTATTTGGCAGAACTC
>probe:Drosophila_2:1627711_at:7:351; Interrogation_Position=1788; Antisense; GCAGAACTCTACACAGTGCAATCGT
>probe:Drosophila_2:1627711_at:179:637; Interrogation_Position=1809; Antisense; TCGTATTGTTAAGCGATTCCATTAA
>probe:Drosophila_2:1627711_at:23:13; Interrogation_Position=1829; Antisense; ATTAATTTTAATGCCCTCGTGACAA
>probe:Drosophila_2:1627711_at:704:233; Interrogation_Position=1838; Antisense; AATGCCCTCGTGACAAGGCGTCAAG
>probe:Drosophila_2:1627711_at:298:653; Interrogation_Position=1890; Antisense; TAATATCGACTATGTGTGTGTGCGT
>probe:Drosophila_2:1627711_at:554:443; Interrogation_Position=1953; Antisense; GATGATCAGGCAGACAACGCCAGAA
>probe:Drosophila_2:1627711_at:575:457; Interrogation_Position=2044; Antisense; GATACCAGGAAAACTCTTGCAATGC
>probe:Drosophila_2:1627711_at:3:19; Interrogation_Position=2144; Antisense; CTTTTATTCGGTCATACACTACGCC
>probe:Drosophila_2:1627711_at:257:537; Interrogation_Position=2153; Antisense; GGTCATACACTACGCCATGCATAGT
>probe:Drosophila_2:1627711_at:387:25; Interrogation_Position=2173; Antisense; ATAGTGCAACATCCTCAACCCGTGA
>probe:Drosophila_2:1627711_at:57:281; Interrogation_Position=2186; Antisense; CTCAACCCGTGAATCTTTCTCAAAA
>probe:Drosophila_2:1627711_at:441:165; Interrogation_Position=2243; Antisense; AAATCCTGTTATACTGTACGGCATT
>probe:Drosophila_2:1627711_at:404:385; Interrogation_Position=2275; Antisense; GAAAATGCAATTCGTCGGCGTTTTA

Paste this into a BLAST search page for me
GCGATTGTTTTATTTGGCAGAACTCGCAGAACTCTACACAGTGCAATCGTTCGTATTGTTAAGCGATTCCATTAAATTAATTTTAATGCCCTCGTGACAAAATGCCCTCGTGACAAGGCGTCAAGTAATATCGACTATGTGTGTGTGCGTGATGATCAGGCAGACAACGCCAGAAGATACCAGGAAAACTCTTGCAATGCCTTTTATTCGGTCATACACTACGCCGGTCATACACTACGCCATGCATAGTATAGTGCAACATCCTCAACCCGTGACTCAACCCGTGAATCTTTCTCAAAAAAATCCTGTTATACTGTACGGCATTGAAAATGCAATTCGTCGGCGTTTTA

Full Affymetrix probeset data:

Annotations for 1627711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720