FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627712_at:

>probe:Drosophila_2:1627712_at:417:323; Interrogation_Position=314; Antisense; GCGCCGCCGTCAAAATGTTCATCTA
>probe:Drosophila_2:1627712_at:153:345; Interrogation_Position=359; Antisense; GCATTTGCCATTCAGTCAACTCGAT
>probe:Drosophila_2:1627712_at:58:653; Interrogation_Position=374; Antisense; TCAACTCGATGGTGGCGCGCTACAA
>probe:Drosophila_2:1627712_at:398:665; Interrogation_Position=394; Antisense; TACAATTCCTTCGACTACTGGCGTT
>probe:Drosophila_2:1627712_at:153:143; Interrogation_Position=425; Antisense; ACTGGAGTCTCATGGACCACGGCGA
>probe:Drosophila_2:1627712_at:104:265; Interrogation_Position=490; Antisense; CAGATTATTAACCTATCGACCGCCT
>probe:Drosophila_2:1627712_at:327:671; Interrogation_Position=514; Antisense; TACGATGTTTACTTTCACGGTGCCG
>probe:Drosophila_2:1627712_at:551:317; Interrogation_Position=535; Antisense; GCCGGCGATGTTCCGAGTATTTCGA
>probe:Drosophila_2:1627712_at:494:375; Interrogation_Position=558; Antisense; GAAGCAAAGGTACACATTCCCGGAA
>probe:Drosophila_2:1627712_at:22:301; Interrogation_Position=609; Antisense; CGCCCTGGAGATCTTTACGAATGAG
>probe:Drosophila_2:1627712_at:312:53; Interrogation_Position=691; Antisense; ATGACGGTGCCCATCTACAGTTTTG
>probe:Drosophila_2:1627712_at:449:599; Interrogation_Position=721; Antisense; TGTCTCTCGGAGTGCAGGATGTTCT
>probe:Drosophila_2:1627712_at:656:77; Interrogation_Position=736; Antisense; AGGATGTTCTTTGCTCTGCGGGTCT
>probe:Drosophila_2:1627712_at:275:149; Interrogation_Position=776; Antisense; ACTTCTACAGGAACCGCTTGCGAAA

Paste this into a BLAST search page for me
GCGCCGCCGTCAAAATGTTCATCTAGCATTTGCCATTCAGTCAACTCGATTCAACTCGATGGTGGCGCGCTACAATACAATTCCTTCGACTACTGGCGTTACTGGAGTCTCATGGACCACGGCGACAGATTATTAACCTATCGACCGCCTTACGATGTTTACTTTCACGGTGCCGGCCGGCGATGTTCCGAGTATTTCGAGAAGCAAAGGTACACATTCCCGGAACGCCCTGGAGATCTTTACGAATGAGATGACGGTGCCCATCTACAGTTTTGTGTCTCTCGGAGTGCAGGATGTTCTAGGATGTTCTTTGCTCTGCGGGTCTACTTCTACAGGAACCGCTTGCGAAA

Full Affymetrix probeset data:

Annotations for 1627712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720