FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627713_at:

>probe:Drosophila_2:1627713_at:145:689; Interrogation_Position=1204; Antisense; TATTACAACACATGCGGACCGAAGT
>probe:Drosophila_2:1627713_at:31:393; Interrogation_Position=1234; Antisense; GAAAGGTGACCCATGGCGGCTCCAG
>probe:Drosophila_2:1627713_at:515:67; Interrogation_Position=1246; Antisense; ATGGCGGCTCCAGTTAGATTTTAAC
>probe:Drosophila_2:1627713_at:484:523; Interrogation_Position=1312; Antisense; GGGCGGAGCCAATCCACATCATGTC
>probe:Drosophila_2:1627713_at:660:503; Interrogation_Position=1334; Antisense; GTCCACAATCCTGACTATTGGCGGA
>probe:Drosophila_2:1627713_at:34:639; Interrogation_Position=1351; Antisense; TTGGCGGACAACTTTACGGGCAACA
>probe:Drosophila_2:1627713_at:45:401; Interrogation_Position=1422; Antisense; GACAGGCAATCGACTGCATCACAGT
>probe:Drosophila_2:1627713_at:128:473; Interrogation_Position=1474; Antisense; GTTAATTGCACTCAACCAGCGTAGA
>probe:Drosophila_2:1627713_at:122:493; Interrogation_Position=1501; Antisense; GTAAGGCATCATTTCTGTAGCTTTA
>probe:Drosophila_2:1627713_at:384:691; Interrogation_Position=1554; Antisense; TATTGGTCAATTGCCACAGCTGAAA
>probe:Drosophila_2:1627713_at:202:387; Interrogation_Position=1575; Antisense; GAAAATAGCCTCTCAACTACTCTTC
>probe:Drosophila_2:1627713_at:492:253; Interrogation_Position=1588; Antisense; CAACTACTCTTCCAATCATCTTAAT
>probe:Drosophila_2:1627713_at:619:9; Interrogation_Position=1620; Antisense; ATTCGTTCTTACGTACGTACGCCAT
>probe:Drosophila_2:1627713_at:511:11; Interrogation_Position=1725; Antisense; ATTAGCAATGGGAACCTGCCGTTTC

Paste this into a BLAST search page for me
TATTACAACACATGCGGACCGAAGTGAAAGGTGACCCATGGCGGCTCCAGATGGCGGCTCCAGTTAGATTTTAACGGGCGGAGCCAATCCACATCATGTCGTCCACAATCCTGACTATTGGCGGATTGGCGGACAACTTTACGGGCAACAGACAGGCAATCGACTGCATCACAGTGTTAATTGCACTCAACCAGCGTAGAGTAAGGCATCATTTCTGTAGCTTTATATTGGTCAATTGCCACAGCTGAAAGAAAATAGCCTCTCAACTACTCTTCCAACTACTCTTCCAATCATCTTAATATTCGTTCTTACGTACGTACGCCATATTAGCAATGGGAACCTGCCGTTTC

Full Affymetrix probeset data:

Annotations for 1627713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720