FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627714_at:

>probe:Drosophila_2:1627714_at:559:375; Interrogation_Position=1059; Antisense; GAAGACCATCAACTACCTGAGCGAG
>probe:Drosophila_2:1627714_at:303:275; Interrogation_Position=1088; Antisense; CTTCGCGTGCGGATGACGGTATACT
>probe:Drosophila_2:1627714_at:358:677; Interrogation_Position=1130; Antisense; TAGAGCTCCGCGATGACAGCGAGGA
>probe:Drosophila_2:1627714_at:685:619; Interrogation_Position=1232; Antisense; TGCTCTGTTGCGATCATCACGGAAA
>probe:Drosophila_2:1627714_at:709:175; Interrogation_Position=1255; Antisense; AAACTCGACCCGGAAAAGCTGCGCT
>probe:Drosophila_2:1627714_at:267:183; Interrogation_Position=1268; Antisense; AAAAGCTGCGCTGCAGTTTCTTCTG
>probe:Drosophila_2:1627714_at:525:273; Interrogation_Position=1305; Antisense; CTTCGGTGTCTACATGGGCTTCAAA
>probe:Drosophila_2:1627714_at:701:679; Interrogation_Position=790; Antisense; TATCCGTATCCCTTTAGCTTTCGGG
>probe:Drosophila_2:1627714_at:523:255; Interrogation_Position=826; Antisense; CAAATCAATGGTGCGGAATCCCGAC
>probe:Drosophila_2:1627714_at:645:365; Interrogation_Position=841; Antisense; GAATCCCGACATGAACTACGCGACT
>probe:Drosophila_2:1627714_at:227:273; Interrogation_Position=876; Antisense; CATTAGCCTATCGAGTGTTTATCAC
>probe:Drosophila_2:1627714_at:262:477; Interrogation_Position=892; Antisense; GTTTATCACGAGTTCGAACGCCAAG
>probe:Drosophila_2:1627714_at:15:557; Interrogation_Position=929; Antisense; GGACTGCACCATCTGTGGATTCGAA
>probe:Drosophila_2:1627714_at:308:463; Interrogation_Position=946; Antisense; GATTCGAAGCCACGCTTCAGCTGGT

Paste this into a BLAST search page for me
GAAGACCATCAACTACCTGAGCGAGCTTCGCGTGCGGATGACGGTATACTTAGAGCTCCGCGATGACAGCGAGGATGCTCTGTTGCGATCATCACGGAAAAAACTCGACCCGGAAAAGCTGCGCTAAAAGCTGCGCTGCAGTTTCTTCTGCTTCGGTGTCTACATGGGCTTCAAATATCCGTATCCCTTTAGCTTTCGGGCAAATCAATGGTGCGGAATCCCGACGAATCCCGACATGAACTACGCGACTCATTAGCCTATCGAGTGTTTATCACGTTTATCACGAGTTCGAACGCCAAGGGACTGCACCATCTGTGGATTCGAAGATTCGAAGCCACGCTTCAGCTGGT

Full Affymetrix probeset data:

Annotations for 1627714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720