FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627716_at:

>probe:Drosophila_2:1627716_at:529:505; Interrogation_Position=1000; Antisense; GTCCACATATTCTACAGCGACGATG
>probe:Drosophila_2:1627716_at:202:179; Interrogation_Position=1053; Antisense; AAACTTTGCCGCCAGAGTGCCGGAG
>probe:Drosophila_2:1627716_at:565:533; Interrogation_Position=1077; Antisense; GGTGGTGATGCACCGGATCTCAACA
>probe:Drosophila_2:1627716_at:80:3; Interrogation_Position=1115; Antisense; ATACGGACTTCGTGCATTCCATGAC
>probe:Drosophila_2:1627716_at:640:7; Interrogation_Position=1130; Antisense; ATTCCATGACCGTTGCTGACGTAAT
>probe:Drosophila_2:1627716_at:330:405; Interrogation_Position=1193; Antisense; GACTCAGCAGTCCTACATTTTTATG
>probe:Drosophila_2:1627716_at:406:349; Interrogation_Position=639; Antisense; GCAGACCGTCTTCAGGAGTTTCATA
>probe:Drosophila_2:1627716_at:510:547; Interrogation_Position=653; Antisense; GGAGTTTCATAATGGCCATGCCCGA
>probe:Drosophila_2:1627716_at:121:581; Interrogation_Position=665; Antisense; TGGCCATGCCCGACAAGGAGTTCAT
>probe:Drosophila_2:1627716_at:606:59; Interrogation_Position=725; Antisense; ATGTATGCGGGCTATTCGTTGCCAG
>probe:Drosophila_2:1627716_at:347:159; Interrogation_Position=760; Antisense; ACAACCTTCTTCTTGATTTCCAACG
>probe:Drosophila_2:1627716_at:247:159; Interrogation_Position=806; Antisense; ACACAAGCGTTATTCCTCTGATTGC
>probe:Drosophila_2:1627716_at:552:101; Interrogation_Position=947; Antisense; AGAGCCTAGAACCTCCAGACTATAC
>probe:Drosophila_2:1627716_at:28:147; Interrogation_Position=965; Antisense; ACTATACTTTGAGCAACGTCCGTCC

Paste this into a BLAST search page for me
GTCCACATATTCTACAGCGACGATGAAACTTTGCCGCCAGAGTGCCGGAGGGTGGTGATGCACCGGATCTCAACAATACGGACTTCGTGCATTCCATGACATTCCATGACCGTTGCTGACGTAATGACTCAGCAGTCCTACATTTTTATGGCAGACCGTCTTCAGGAGTTTCATAGGAGTTTCATAATGGCCATGCCCGATGGCCATGCCCGACAAGGAGTTCATATGTATGCGGGCTATTCGTTGCCAGACAACCTTCTTCTTGATTTCCAACGACACAAGCGTTATTCCTCTGATTGCAGAGCCTAGAACCTCCAGACTATACACTATACTTTGAGCAACGTCCGTCC

Full Affymetrix probeset data:

Annotations for 1627716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720