Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627719_at:

>probe:Drosophila_2:1627719_at:170:265; Interrogation_Position=1811; Antisense; TACTTCCGAGTATGAACCCTTAAAT
>probe:Drosophila_2:1627719_at:503:243; Interrogation_Position=1921; Antisense; AATATAGCAAGATCACCGACTGTGT
>probe:Drosophila_2:1627719_at:642:449; Interrogation_Position=1931; Antisense; GATCACCGACTGTGTTGCTAGTCAC
>probe:Drosophila_2:1627719_at:584:721; Interrogation_Position=1945; Antisense; TTGCTAGTCACCCATAGACGGCTAC
>probe:Drosophila_2:1627719_at:516:105; Interrogation_Position=1960; Antisense; AGACGGCTACACAAATCGCAGCCAG
>probe:Drosophila_2:1627719_at:420:635; Interrogation_Position=1975; Antisense; TCGCAGCCAGCGCATATTGTGAATC
>probe:Drosophila_2:1627719_at:8:407; Interrogation_Position=2003; Antisense; GACTGCTGTAATATCACAGGTGCCA
>probe:Drosophila_2:1627719_at:38:153; Interrogation_Position=2018; Antisense; ACAGGTGCCAAAGTATTTGCTTTTA
>probe:Drosophila_2:1627719_at:363:343; Interrogation_Position=2096; Antisense; GCTTAATTCGTTTGATTGCATTTAT
>probe:Drosophila_2:1627719_at:552:703; Interrogation_Position=2244; Antisense; TTGAGTTTATGAAGAAATCCCGAGT
>probe:Drosophila_2:1627719_at:694:233; Interrogation_Position=2259; Antisense; AATCCCGAGTAGTTTCTTGAATTTG
>probe:Drosophila_2:1627719_at:329:475; Interrogation_Position=2283; Antisense; GTTATTTGCTTTATCACCAACTTTG
>probe:Drosophila_2:1627719_at:226:159; Interrogation_Position=2310; Antisense; ACAAGACCATGCTGTGCTAGACACC
>probe:Drosophila_2:1627719_at:237:509; Interrogation_Position=2323; Antisense; GTGCTAGACACCTCCAACATATTAA

Paste this into a BLAST search page for me
TACTTCCGAGTATGAACCCTTAAATAATATAGCAAGATCACCGACTGTGTGATCACCGACTGTGTTGCTAGTCACTTGCTAGTCACCCATAGACGGCTACAGACGGCTACACAAATCGCAGCCAGTCGCAGCCAGCGCATATTGTGAATCGACTGCTGTAATATCACAGGTGCCAACAGGTGCCAAAGTATTTGCTTTTAGCTTAATTCGTTTGATTGCATTTATTTGAGTTTATGAAGAAATCCCGAGTAATCCCGAGTAGTTTCTTGAATTTGGTTATTTGCTTTATCACCAACTTTGACAAGACCATGCTGTGCTAGACACCGTGCTAGACACCTCCAACATATTAA

Full Affymetrix probeset data:

Annotations for 1627719_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime