FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627720_at:

>probe:Drosophila_2:1627720_at:347:549; Interrogation_Position=165; Antisense; GGAGATACCGGACAACTTTCTTAGC
>probe:Drosophila_2:1627720_at:250:705; Interrogation_Position=185; Antisense; TTAGCCCCTCGGTTCGGGAGTATCT
>probe:Drosophila_2:1627720_at:424:347; Interrogation_Position=20; Antisense; GCATCGCCGCTAATTGTAATTGCCA
>probe:Drosophila_2:1627720_at:343:429; Interrogation_Position=202; Antisense; GAGTATCTCGAGCTGGGCAAATCCA
>probe:Drosophila_2:1627720_at:176:611; Interrogation_Position=246; Antisense; TGACTATCCCATACTGTCGGCGGTG
>probe:Drosophila_2:1627720_at:349:491; Interrogation_Position=273; Antisense; GTACACCAACTTTTACTGCGACGAG
>probe:Drosophila_2:1627720_at:525:91; Interrogation_Position=302; Antisense; AGTATCCTGGATTCTTTGCCGACAT
>probe:Drosophila_2:1627720_at:443:83; Interrogation_Position=341; Antisense; AGGGCTGGCATTACTGCGACATCGA
>probe:Drosophila_2:1627720_at:400:151; Interrogation_Position=359; Antisense; ACATCGATGGACGACAGGCCACGTT
>probe:Drosophila_2:1627720_at:139:229; Interrogation_Position=394; Antisense; AATGGCACACAGTTCTCACAGGCGG
>probe:Drosophila_2:1627720_at:360:143; Interrogation_Position=431; Antisense; ACTGGTGGTTCAATGTGCGCTGCGA
>probe:Drosophila_2:1627720_at:723:389; Interrogation_Position=46; Antisense; GAAACAGTTCGTTCCAAGCGAGCCA
>probe:Drosophila_2:1627720_at:437:195; Interrogation_Position=545; Antisense; AACTGGTCGAGGACATCTTCACCTG
>probe:Drosophila_2:1627720_at:449:537; Interrogation_Position=93; Antisense; GGTAAACTTTGAGCCGGAGCCGCAG

Paste this into a BLAST search page for me
GGAGATACCGGACAACTTTCTTAGCTTAGCCCCTCGGTTCGGGAGTATCTGCATCGCCGCTAATTGTAATTGCCAGAGTATCTCGAGCTGGGCAAATCCATGACTATCCCATACTGTCGGCGGTGGTACACCAACTTTTACTGCGACGAGAGTATCCTGGATTCTTTGCCGACATAGGGCTGGCATTACTGCGACATCGAACATCGATGGACGACAGGCCACGTTAATGGCACACAGTTCTCACAGGCGGACTGGTGGTTCAATGTGCGCTGCGAGAAACAGTTCGTTCCAAGCGAGCCAAACTGGTCGAGGACATCTTCACCTGGGTAAACTTTGAGCCGGAGCCGCAG

Full Affymetrix probeset data:

Annotations for 1627720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720