FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627721_at:

>probe:Drosophila_2:1627721_at:683:715; Interrogation_Position=1469; Antisense; TTCCGTCCAGTTTCCACTTGGAATA
>probe:Drosophila_2:1627721_at:159:729; Interrogation_Position=1486; Antisense; TTGGAATACCCAATCCTGGCGAATC
>probe:Drosophila_2:1627721_at:522:581; Interrogation_Position=1502; Antisense; TGGCGAATCCCGATCACATCTATAG
>probe:Drosophila_2:1627721_at:412:151; Interrogation_Position=1517; Antisense; ACATCTATAGCATCCTGGCCAAATG
>probe:Drosophila_2:1627721_at:337:327; Interrogation_Position=1552; Antisense; GCGATGGGTGCGTTCTATTTTTATA
>probe:Drosophila_2:1627721_at:290:509; Interrogation_Position=1620; Antisense; GTGCATCTCATATCCATCCATGTGG
>probe:Drosophila_2:1627721_at:15:49; Interrogation_Position=1635; Antisense; ATCCATGTGGTCAGCCATATCAGCA
>probe:Drosophila_2:1627721_at:277:401; Interrogation_Position=1681; Antisense; GACATGACTTCATTCGAGATTTCAA
>probe:Drosophila_2:1627721_at:2:511; Interrogation_Position=1833; Antisense; GTGAAATATTCGAGTGGCACTTCTT
>probe:Drosophila_2:1627721_at:566:567; Interrogation_Position=1848; Antisense; GGCACTTCTTCATACACATATCGTT
>probe:Drosophila_2:1627721_at:658:13; Interrogation_Position=1865; Antisense; ATATCGTTTTGATCGGAAATCCCAA
>probe:Drosophila_2:1627721_at:126:393; Interrogation_Position=1880; Antisense; GAAATCCCAAAATCCTTTTCCTATG
>probe:Drosophila_2:1627721_at:575:277; Interrogation_Position=1900; Antisense; CTATGAAGGACACCCCATCCGAAGG
>probe:Drosophila_2:1627721_at:535:675; Interrogation_Position=1943; Antisense; TAGCTAAGCAACTGCGGCAAGCAAT

Paste this into a BLAST search page for me
TTCCGTCCAGTTTCCACTTGGAATATTGGAATACCCAATCCTGGCGAATCTGGCGAATCCCGATCACATCTATAGACATCTATAGCATCCTGGCCAAATGGCGATGGGTGCGTTCTATTTTTATAGTGCATCTCATATCCATCCATGTGGATCCATGTGGTCAGCCATATCAGCAGACATGACTTCATTCGAGATTTCAAGTGAAATATTCGAGTGGCACTTCTTGGCACTTCTTCATACACATATCGTTATATCGTTTTGATCGGAAATCCCAAGAAATCCCAAAATCCTTTTCCTATGCTATGAAGGACACCCCATCCGAAGGTAGCTAAGCAACTGCGGCAAGCAAT

Full Affymetrix probeset data:

Annotations for 1627721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720