FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627723_at:

>probe:Drosophila_2:1627723_at:580:39; Interrogation_Position=101; Antisense; ATCGATTTCAGATCTCCAAGGAGGA
>probe:Drosophila_2:1627723_at:119:281; Interrogation_Position=114; Antisense; CTCCAAGGAGGAGCTAATCGAGGGC
>probe:Drosophila_2:1627723_at:282:57; Interrogation_Position=13; Antisense; ATGAGCATCTATCACGACGAGGTGG
>probe:Drosophila_2:1627723_at:309:435; Interrogation_Position=139; Antisense; GAGGAGGTGGCCACCTGTCCCAGCT
>probe:Drosophila_2:1627723_at:612:119; Interrogation_Position=160; Antisense; AGCTGCTCCCTAGTCATCAAGGTCA
>probe:Drosophila_2:1627723_at:287:497; Interrogation_Position=172; Antisense; GTCATCAAGGTCATATACGATCCGG
>probe:Drosophila_2:1627723_at:30:671; Interrogation_Position=187; Antisense; TACGATCCGGAGATGTTCAAAGCTG
>probe:Drosophila_2:1627723_at:537:37; Interrogation_Position=19; Antisense; ATCTATCACGACGAGGTGGAGATCG
>probe:Drosophila_2:1627723_at:251:75; Interrogation_Position=215; Antisense; AGGATGAAGAAAGTGCGCTGAACGA
>probe:Drosophila_2:1627723_at:57:109; Interrogation_Position=239; Antisense; AGAAGCTCGGCGACCTGAAGCTCGA
>probe:Drosophila_2:1627723_at:241:575; Interrogation_Position=247; Antisense; GGCGACCTGAAGCTCGAGAAGAACT
>probe:Drosophila_2:1627723_at:660:549; Interrogation_Position=69; Antisense; GGAGATGTACTACTATCCCTGTCCA
>probe:Drosophila_2:1627723_at:195:683; Interrogation_Position=82; Antisense; TATCCCTGTCCATGCGGCGATCGAT
>probe:Drosophila_2:1627723_at:261:505; Interrogation_Position=89; Antisense; GTCCATGCGGCGATCGATTTCAGAT

Paste this into a BLAST search page for me
ATCGATTTCAGATCTCCAAGGAGGACTCCAAGGAGGAGCTAATCGAGGGCATGAGCATCTATCACGACGAGGTGGGAGGAGGTGGCCACCTGTCCCAGCTAGCTGCTCCCTAGTCATCAAGGTCAGTCATCAAGGTCATATACGATCCGGTACGATCCGGAGATGTTCAAAGCTGATCTATCACGACGAGGTGGAGATCGAGGATGAAGAAAGTGCGCTGAACGAAGAAGCTCGGCGACCTGAAGCTCGAGGCGACCTGAAGCTCGAGAAGAACTGGAGATGTACTACTATCCCTGTCCATATCCCTGTCCATGCGGCGATCGATGTCCATGCGGCGATCGATTTCAGAT

Full Affymetrix probeset data:

Annotations for 1627723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720