FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627725_at:

>probe:Drosophila_2:1627725_at:490:207; Interrogation_Position=452; Antisense; AAGCTGTTGCTACGGATTCGTCGAC
>probe:Drosophila_2:1627725_at:300:7; Interrogation_Position=467; Antisense; ATTCGTCGACTACGTGTCGGAACGC
>probe:Drosophila_2:1627725_at:76:229; Interrogation_Position=510; Antisense; AATGGCATGGATGGCTACGAGACTC
>probe:Drosophila_2:1627725_at:378:331; Interrogation_Position=535; Antisense; GCGGCAAGCGACTGAAAGTGGCCTT
>probe:Drosophila_2:1627725_at:132:381; Interrogation_Position=608; Antisense; GAACCTGCCCACGTACATGGATGAG
>probe:Drosophila_2:1627725_at:662:371; Interrogation_Position=635; Antisense; GAAGGTACGAGAACTCTTCGCCACC
>probe:Drosophila_2:1627725_at:206:43; Interrogation_Position=669; Antisense; ATCGTGGATGTGAACTTGCTGCGCC
>probe:Drosophila_2:1627725_at:598:621; Interrogation_Position=685; Antisense; TGCTGCGCCACAAGTTCAACAATAG
>probe:Drosophila_2:1627725_at:267:651; Interrogation_Position=700; Antisense; TCAACAATAGGTCCCGTGGCGTGGC
>probe:Drosophila_2:1627725_at:634:329; Interrogation_Position=718; Antisense; GCGTGGCCTTCTTGCAATTTGAGTT
>probe:Drosophila_2:1627725_at:71:245; Interrogation_Position=733; Antisense; AATTTGAGTTGGTCCGCGACGCCGA
>probe:Drosophila_2:1627725_at:633:39; Interrogation_Position=778; Antisense; ATCGGTACATGATCGAAGGCGCCTC
>probe:Drosophila_2:1627725_at:96:181; Interrogation_Position=838; Antisense; AAAAAGGCTCGAGTTCTACCTCCAG
>probe:Drosophila_2:1627725_at:465:453; Interrogation_Position=930; Antisense; GATCATCATGTGTCTAAGCGTTCTC

Paste this into a BLAST search page for me
AAGCTGTTGCTACGGATTCGTCGACATTCGTCGACTACGTGTCGGAACGCAATGGCATGGATGGCTACGAGACTCGCGGCAAGCGACTGAAAGTGGCCTTGAACCTGCCCACGTACATGGATGAGGAAGGTACGAGAACTCTTCGCCACCATCGTGGATGTGAACTTGCTGCGCCTGCTGCGCCACAAGTTCAACAATAGTCAACAATAGGTCCCGTGGCGTGGCGCGTGGCCTTCTTGCAATTTGAGTTAATTTGAGTTGGTCCGCGACGCCGAATCGGTACATGATCGAAGGCGCCTCAAAAAGGCTCGAGTTCTACCTCCAGGATCATCATGTGTCTAAGCGTTCTC

Full Affymetrix probeset data:

Annotations for 1627725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720