FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627728_at:

>probe:Drosophila_2:1627728_at:643:91; Interrogation_Position=1026; Antisense; AGTATTACTTCTACCATTTGCTGGA
>probe:Drosophila_2:1627728_at:383:333; Interrogation_Position=1045; Antisense; GCTGGATAACCTCAAAGCTCTTAAT
>probe:Drosophila_2:1627728_at:500:567; Interrogation_Position=1076; Antisense; GGCAGTCTACCGCAGTTGCAGCATA
>probe:Drosophila_2:1627728_at:447:723; Interrogation_Position=1091; Antisense; TTGCAGCATATTCGCGATGCCCTAA
>probe:Drosophila_2:1627728_at:241:407; Interrogation_Position=1125; Antisense; GACTGGCTGCCTATGTGGTGGTCAC
>probe:Drosophila_2:1627728_at:604:577; Interrogation_Position=1153; Antisense; GGCCCTGCCCATAACGATGATGAAT
>probe:Drosophila_2:1627728_at:75:231; Interrogation_Position=1216; Antisense; AATGAAGTGCGCCATGTTCACCAGC
>probe:Drosophila_2:1627728_at:299:657; Interrogation_Position=1261; Antisense; TAAGGATATCCTGCCCTGGATGGAG
>probe:Drosophila_2:1627728_at:368:323; Interrogation_Position=1288; Antisense; GCGCTCCCTTCTTAATTAGTCATGA
>probe:Drosophila_2:1627728_at:479:325; Interrogation_Position=849; Antisense; GCGACTGCTGGGTGAACAACGTTAT
>probe:Drosophila_2:1627728_at:476:471; Interrogation_Position=869; Antisense; GTTATGTTCAAGTTCGACGACTCCG
>probe:Drosophila_2:1627728_at:327:355; Interrogation_Position=911; Antisense; GCACTGCTCGATTACCAGTTGGTCA
>probe:Drosophila_2:1627728_at:319:589; Interrogation_Position=940; Antisense; TGGATCTCCTGCCATTGATTTGTAC
>probe:Drosophila_2:1627728_at:666:665; Interrogation_Position=965; Antisense; TACACCATTTTGTCGTCCGCTGAAA

Paste this into a BLAST search page for me
AGTATTACTTCTACCATTTGCTGGAGCTGGATAACCTCAAAGCTCTTAATGGCAGTCTACCGCAGTTGCAGCATATTGCAGCATATTCGCGATGCCCTAAGACTGGCTGCCTATGTGGTGGTCACGGCCCTGCCCATAACGATGATGAATAATGAAGTGCGCCATGTTCACCAGCTAAGGATATCCTGCCCTGGATGGAGGCGCTCCCTTCTTAATTAGTCATGAGCGACTGCTGGGTGAACAACGTTATGTTATGTTCAAGTTCGACGACTCCGGCACTGCTCGATTACCAGTTGGTCATGGATCTCCTGCCATTGATTTGTACTACACCATTTTGTCGTCCGCTGAAA

Full Affymetrix probeset data:

Annotations for 1627728_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720