FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627730_at:

>probe:Drosophila_2:1627730_at:433:349; Interrogation_Position=133; Antisense; GCAGGATCGCGCAGGAGCCCTTCTA
>probe:Drosophila_2:1627730_at:51:275; Interrogation_Position=152; Antisense; CTTCTAGCGAGGACCAGGGCCAGGA
>probe:Drosophila_2:1627730_at:246:15; Interrogation_Position=188; Antisense; ATTATGCCATTGACGGTGGCCAAGT
>probe:Drosophila_2:1627730_at:237:579; Interrogation_Position=205; Antisense; GGCCAAGTCCGCCAGAAGACCAAGG
>probe:Drosophila_2:1627730_at:677:689; Interrogation_Position=21; Antisense; TTTGGAACAGGGACACGTCCTCCTG
>probe:Drosophila_2:1627730_at:668:103; Interrogation_Position=269; Antisense; AGACCCGGAGCTACTGCACCAGTGA
>probe:Drosophila_2:1627730_at:445:339; Interrogation_Position=336; Antisense; GCTATCGCAGCGGAGGCCACAGACG
>probe:Drosophila_2:1627730_at:166:155; Interrogation_Position=368; Antisense; ACAGAAAATCAAACGCCTTCCTGGA
>probe:Drosophila_2:1627730_at:114:587; Interrogation_Position=389; Antisense; TGGACGTGCCCACCATGAACATGCA
>probe:Drosophila_2:1627730_at:137:613; Interrogation_Position=404; Antisense; TGAACATGCATCACCTGCGCGTCAA
>probe:Drosophila_2:1627730_at:282:595; Interrogation_Position=444; Antisense; TGTGGACAGATTGCGCACTTTCAGC
>probe:Drosophila_2:1627730_at:685:593; Interrogation_Position=505; Antisense; TGGGACCTGGGAACACGCACATCAT
>probe:Drosophila_2:1627730_at:384:559; Interrogation_Position=535; Antisense; GGACACACGATACACGAGACGGCAT
>probe:Drosophila_2:1627730_at:142:117; Interrogation_Position=99; Antisense; AGCATTGGCGCTGATTGCATTTGGA

Paste this into a BLAST search page for me
GCAGGATCGCGCAGGAGCCCTTCTACTTCTAGCGAGGACCAGGGCCAGGAATTATGCCATTGACGGTGGCCAAGTGGCCAAGTCCGCCAGAAGACCAAGGTTTGGAACAGGGACACGTCCTCCTGAGACCCGGAGCTACTGCACCAGTGAGCTATCGCAGCGGAGGCCACAGACGACAGAAAATCAAACGCCTTCCTGGATGGACGTGCCCACCATGAACATGCATGAACATGCATCACCTGCGCGTCAATGTGGACAGATTGCGCACTTTCAGCTGGGACCTGGGAACACGCACATCATGGACACACGATACACGAGACGGCATAGCATTGGCGCTGATTGCATTTGGA

Full Affymetrix probeset data:

Annotations for 1627730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720