FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627731_at:

>probe:Drosophila_2:1627731_at:510:159; Interrogation_Position=1034; Antisense; ACAAACCCAGCTACATTGCTCGCTT
>probe:Drosophila_2:1627731_at:350:439; Interrogation_Position=1068; Antisense; GAGGCCCATGGAGGGCGACATTCAA
>probe:Drosophila_2:1627731_at:615:675; Interrogation_Position=534; Antisense; TAGCATGTTCTACTTCACAAGGGAT
>probe:Drosophila_2:1627731_at:68:45; Interrogation_Position=581; Antisense; ATCGCCAGCAGATGGAGATTTTGCA
>probe:Drosophila_2:1627731_at:615:169; Interrogation_Position=614; Antisense; AAAGGCGGCAGATTAACCGGGAGCT
>probe:Drosophila_2:1627731_at:66:709; Interrogation_Position=626; Antisense; TTAACCGGGAGCTCAAGCTAAAGGA
>probe:Drosophila_2:1627731_at:396:661; Interrogation_Position=644; Antisense; TAAAGGAGAACCAGTGCCGCCGCAT
>probe:Drosophila_2:1627731_at:13:371; Interrogation_Position=747; Antisense; GAAGGATCAGCAGAATGACTCGATA
>probe:Drosophila_2:1627731_at:729:605; Interrogation_Position=776; Antisense; TGATCGGATCGGAGCCGGTGCATTC
>probe:Drosophila_2:1627731_at:517:387; Interrogation_Position=868; Antisense; GAAAAAGATCTGGAGCGAGCGAATG
>probe:Drosophila_2:1627731_at:286:417; Interrogation_Position=884; Antisense; GAGCGAATGAACTCCAGCGGCACGA
>probe:Drosophila_2:1627731_at:574:295; Interrogation_Position=909; Antisense; CCGCATATACGAGCTGTTTTGGTTG
>probe:Drosophila_2:1627731_at:177:483; Interrogation_Position=957; Antisense; GTATCGCCGAAAATTGGAACAGAAT
>probe:Drosophila_2:1627731_at:253:393; Interrogation_Position=991; Antisense; GAAATCCCAAATGACTGCCACAAGG

Paste this into a BLAST search page for me
ACAAACCCAGCTACATTGCTCGCTTGAGGCCCATGGAGGGCGACATTCAATAGCATGTTCTACTTCACAAGGGATATCGCCAGCAGATGGAGATTTTGCAAAAGGCGGCAGATTAACCGGGAGCTTTAACCGGGAGCTCAAGCTAAAGGATAAAGGAGAACCAGTGCCGCCGCATGAAGGATCAGCAGAATGACTCGATATGATCGGATCGGAGCCGGTGCATTCGAAAAAGATCTGGAGCGAGCGAATGGAGCGAATGAACTCCAGCGGCACGACCGCATATACGAGCTGTTTTGGTTGGTATCGCCGAAAATTGGAACAGAATGAAATCCCAAATGACTGCCACAAGG

Full Affymetrix probeset data:

Annotations for 1627731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720