Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627732_s_at:

>probe:Drosophila_2:1627732_s_at:401:271; Interrogation_Position=114; Antisense; CATACACTTTCTCCGCGAAGATAGC
>probe:Drosophila_2:1627732_s_at:704:373; Interrogation_Position=130; Antisense; GAAGATAGCCCAATTCCCCATCAAG
>probe:Drosophila_2:1627732_s_at:401:65; Interrogation_Position=172; Antisense; ATGGATCTGGCGCTACTACTTCATT
>probe:Drosophila_2:1627732_s_at:330:329; Interrogation_Position=210; Antisense; GCGTGCCCGTGTTCTACAAGATCAG
>probe:Drosophila_2:1627732_s_at:364:277; Interrogation_Position=307; Antisense; CTAGGCGGCCAGTAACTTAGTCTTA
>probe:Drosophila_2:1627732_s_at:258:727; Interrogation_Position=333; Antisense; TTGTCGCATCAACATTTCAGAGCTG
>probe:Drosophila_2:1627732_s_at:276:713; Interrogation_Position=348; Antisense; TTCAGAGCTGTTTGTGTCGGACCCA
>probe:Drosophila_2:1627732_s_at:527:513; Interrogation_Position=361; Antisense; GTGTCGGACCCAACGTGAAATCGGC
>probe:Drosophila_2:1627732_s_at:546:119; Interrogation_Position=40; Antisense; AGCTGCGAATTCCACGACTACCATG
>probe:Drosophila_2:1627732_s_at:86:511; Interrogation_Position=431; Antisense; GTGCACTGCAACATCCAAATACGGT
>probe:Drosophila_2:1627732_s_at:266:29; Interrogation_Position=449; Antisense; ATACGGTCTTATTATGCGGCTATGA
>probe:Drosophila_2:1627732_s_at:219:623; Interrogation_Position=463; Antisense; TGCGGCTATGACACCACCTATGAGT
>probe:Drosophila_2:1627732_s_at:645:129; Interrogation_Position=478; Antisense; ACCTATGAGTTGAGTTCGGTCACAC
>probe:Drosophila_2:1627732_s_at:235:395; Interrogation_Position=68; Antisense; GACAAAGCTGCTGCCGAGAAACCCG

Paste this into a BLAST search page for me
CATACACTTTCTCCGCGAAGATAGCGAAGATAGCCCAATTCCCCATCAAGATGGATCTGGCGCTACTACTTCATTGCGTGCCCGTGTTCTACAAGATCAGCTAGGCGGCCAGTAACTTAGTCTTATTGTCGCATCAACATTTCAGAGCTGTTCAGAGCTGTTTGTGTCGGACCCAGTGTCGGACCCAACGTGAAATCGGCAGCTGCGAATTCCACGACTACCATGGTGCACTGCAACATCCAAATACGGTATACGGTCTTATTATGCGGCTATGATGCGGCTATGACACCACCTATGAGTACCTATGAGTTGAGTTCGGTCACACGACAAAGCTGCTGCCGAGAAACCCG

Full Affymetrix probeset data:

Annotations for 1627732_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime