FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627734_at:

>probe:Drosophila_2:1627734_at:480:457; Interrogation_Position=1013; Antisense; GATATTGCGCAATGCCATCGAGTAT
>probe:Drosophila_2:1627734_at:419:73; Interrogation_Position=1063; Antisense; AGGAATCCAGTACCACACGCGATGG
>probe:Drosophila_2:1627734_at:201:441; Interrogation_Position=1083; Antisense; GATGGCGACAACCTGGCGCCCAGTT
>probe:Drosophila_2:1627734_at:276:183; Interrogation_Position=1116; Antisense; AAAAGCTGCCAGTCCGATTATCTGA
>probe:Drosophila_2:1627734_at:347:461; Interrogation_Position=1131; Antisense; GATTATCTGAGCTCCTATGCTGGCG
>probe:Drosophila_2:1627734_at:83:497; Interrogation_Position=1207; Antisense; GTCAGTTTACAGACTTTGATGGCAA
>probe:Drosophila_2:1627734_at:24:229; Interrogation_Position=1236; Antisense; AATGGCTCCAGTTTGGACTGTCTAA
>probe:Drosophila_2:1627734_at:113:113; Interrogation_Position=1287; Antisense; AGCACCACGAGTCCCATTCAAAATA
>probe:Drosophila_2:1627734_at:692:147; Interrogation_Position=1371; Antisense; ACTTCTCTGCACGTGAACTTCAAAC
>probe:Drosophila_2:1627734_at:9:511; Interrogation_Position=1400; Antisense; GTGCAGCACTTAGCACTTAAGTATC
>probe:Drosophila_2:1627734_at:705:217; Interrogation_Position=1418; Antisense; AAGTATCAGCACCTTAGGCAATTGT
>probe:Drosophila_2:1627734_at:524:455; Interrogation_Position=1460; Antisense; GATACACGAGATACCCAGTGACCCG
>probe:Drosophila_2:1627734_at:172:265; Interrogation_Position=1475; Antisense; CAGTGACCCGAATAGGCCTTAAATT
>probe:Drosophila_2:1627734_at:534:123; Interrogation_Position=994; Antisense; AGCGCCTGCCGAAGGTTGAGATATT

Paste this into a BLAST search page for me
GATATTGCGCAATGCCATCGAGTATAGGAATCCAGTACCACACGCGATGGGATGGCGACAACCTGGCGCCCAGTTAAAAGCTGCCAGTCCGATTATCTGAGATTATCTGAGCTCCTATGCTGGCGGTCAGTTTACAGACTTTGATGGCAAAATGGCTCCAGTTTGGACTGTCTAAAGCACCACGAGTCCCATTCAAAATAACTTCTCTGCACGTGAACTTCAAACGTGCAGCACTTAGCACTTAAGTATCAAGTATCAGCACCTTAGGCAATTGTGATACACGAGATACCCAGTGACCCGCAGTGACCCGAATAGGCCTTAAATTAGCGCCTGCCGAAGGTTGAGATATT

Full Affymetrix probeset data:

Annotations for 1627734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720