FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627736_at:

>probe:Drosophila_2:1627736_at:203:539; Interrogation_Position=3123; Antisense; GGTATTATTAAACGAGACTTGCCAA
>probe:Drosophila_2:1627736_at:604:423; Interrogation_Position=3136; Antisense; GAGACTTGCCAAAAATGGTTGTTGA
>probe:Drosophila_2:1627736_at:628:465; Interrogation_Position=3153; Antisense; GTTGTTGATGAGTGTGGTTGCCCTT
>probe:Drosophila_2:1627736_at:141:53; Interrogation_Position=3160; Antisense; ATGAGTGTGGTTGCCCTTAGCCTTG
>probe:Drosophila_2:1627736_at:357:307; Interrogation_Position=3174; Antisense; CCTTAGCCTTGCCTTACAATTTTAT
>probe:Drosophila_2:1627736_at:114:249; Interrogation_Position=3190; Antisense; CAATTTTATATTTTCCGTCCGATAG
>probe:Drosophila_2:1627736_at:109:23; Interrogation_Position=3223; Antisense; ATATATGTGTCCTAACTGAGCGCCA
>probe:Drosophila_2:1627736_at:549:63; Interrogation_Position=3227; Antisense; ATGTGTCCTAACTGAGCGCCAATCT
>probe:Drosophila_2:1627736_at:165:323; Interrogation_Position=3242; Antisense; GCGCCAATCTCTTAACGAAATCTTT
>probe:Drosophila_2:1627736_at:86:703; Interrogation_Position=3316; Antisense; TTATTTTATACTTAGCTATGCTGGT
>probe:Drosophila_2:1627736_at:426:341; Interrogation_Position=3330; Antisense; GCTATGCTGGTGACAATATTTGTAT
>probe:Drosophila_2:1627736_at:637:435; Interrogation_Position=3376; Antisense; GAGGAAGTGCCTAAATTACGTTAAT
>probe:Drosophila_2:1627736_at:506:31; Interrogation_Position=3539; Antisense; ATAACATGAGCAAAGCGTCGCGCTT
>probe:Drosophila_2:1627736_at:239:329; Interrogation_Position=3553; Antisense; GCGTCGCGCTTTTTTTATTGTCAAA

Paste this into a BLAST search page for me
GGTATTATTAAACGAGACTTGCCAAGAGACTTGCCAAAAATGGTTGTTGAGTTGTTGATGAGTGTGGTTGCCCTTATGAGTGTGGTTGCCCTTAGCCTTGCCTTAGCCTTGCCTTACAATTTTATCAATTTTATATTTTCCGTCCGATAGATATATGTGTCCTAACTGAGCGCCAATGTGTCCTAACTGAGCGCCAATCTGCGCCAATCTCTTAACGAAATCTTTTTATTTTATACTTAGCTATGCTGGTGCTATGCTGGTGACAATATTTGTATGAGGAAGTGCCTAAATTACGTTAATATAACATGAGCAAAGCGTCGCGCTTGCGTCGCGCTTTTTTTATTGTCAAA

Full Affymetrix probeset data:

Annotations for 1627736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720