Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627737_at:

>probe:Drosophila_2:1627737_at:263:389; Interrogation_Position=2759; Antisense; GAAACAGGTGCTTGATCCACTCATG
>probe:Drosophila_2:1627737_at:554:725; Interrogation_Position=2770; Antisense; TTGATCCACTCATGCGATCGCTGGG
>probe:Drosophila_2:1627737_at:417:45; Interrogation_Position=2786; Antisense; ATCGCTGGGCGTTATACTCGCTGAA
>probe:Drosophila_2:1627737_at:462:263; Interrogation_Position=2815; Antisense; CAGCAAAGGCAGGAGGTGTACACCA
>probe:Drosophila_2:1627737_at:106:81; Interrogation_Position=2828; Antisense; AGGTGTACACCAGGAGCAGTAGATC
>probe:Drosophila_2:1627737_at:258:115; Interrogation_Position=2842; Antisense; AGCAGTAGATCCTCCAAGCATCGAT
>probe:Drosophila_2:1627737_at:169:115; Interrogation_Position=2858; Antisense; AGCATCGATCATTTTATCCATCTGG
>probe:Drosophila_2:1627737_at:366:683; Interrogation_Position=2872; Antisense; TATCCATCTGGCTGTCGTCTAAATT
>probe:Drosophila_2:1627737_at:242:501; Interrogation_Position=2885; Antisense; GTCGTCTAAATTGCTCATTTTCCAA
>probe:Drosophila_2:1627737_at:503:15; Interrogation_Position=2919; Antisense; ATTATTATTCACTAGTTCCGCTTGT
>probe:Drosophila_2:1627737_at:680:147; Interrogation_Position=2929; Antisense; ACTAGTTCCGCTTGTGTCGGTCAAA
>probe:Drosophila_2:1627737_at:620:341; Interrogation_Position=2938; Antisense; GCTTGTGTCGGTCAAATGCGAGACT
>probe:Drosophila_2:1627737_at:471:245; Interrogation_Position=2964; Antisense; AATTGTTAAGTATTGTTCGTGCAAA
>probe:Drosophila_2:1627737_at:371:239; Interrogation_Position=2987; Antisense; AATAAAATGCTAACTTCGAACGAAT

Paste this into a BLAST search page for me
GAAACAGGTGCTTGATCCACTCATGTTGATCCACTCATGCGATCGCTGGGATCGCTGGGCGTTATACTCGCTGAACAGCAAAGGCAGGAGGTGTACACCAAGGTGTACACCAGGAGCAGTAGATCAGCAGTAGATCCTCCAAGCATCGATAGCATCGATCATTTTATCCATCTGGTATCCATCTGGCTGTCGTCTAAATTGTCGTCTAAATTGCTCATTTTCCAAATTATTATTCACTAGTTCCGCTTGTACTAGTTCCGCTTGTGTCGGTCAAAGCTTGTGTCGGTCAAATGCGAGACTAATTGTTAAGTATTGTTCGTGCAAAAATAAAATGCTAACTTCGAACGAAT

Full Affymetrix probeset data:

Annotations for 1627737_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime