Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627741_at:

>probe:Drosophila_2:1627741_at:534:561; Interrogation_Position=112; Antisense; GGAACACGGTGCAGGAATCCCTATG
>probe:Drosophila_2:1627741_at:179:193; Interrogation_Position=151; Antisense; AACTATTGCTACTTCGTTGCTGACG
>probe:Drosophila_2:1627741_at:686:693; Interrogation_Position=206; Antisense; TTTGCTATCAGGACAAGCGCACCTC
>probe:Drosophila_2:1627741_at:478:261; Interrogation_Position=225; Antisense; CACCTCACGAGTTTGCCTGGATAGT
>probe:Drosophila_2:1627741_at:65:437; Interrogation_Position=253; Antisense; GAGGAAATGCGCGTTCTGGCCCATC
>probe:Drosophila_2:1627741_at:141:531; Interrogation_Position=339; Antisense; GGGTGATAACCGCTTCTACTGGAAC
>probe:Drosophila_2:1627741_at:481:395; Interrogation_Position=36; Antisense; GAAATATCGCCGGATTCGACTCCAC
>probe:Drosophila_2:1627741_at:564:651; Interrogation_Position=386; Antisense; TCAACTACTCCAACTGGGCGGTGGA
>probe:Drosophila_2:1627741_at:297:169; Interrogation_Position=425; Antisense; AAATGGGCCGCAATTGCCTGATCCT
>probe:Drosophila_2:1627741_at:262:131; Interrogation_Position=496; Antisense; ACCCGAGCGGTCGATATCTGCGAAC
>probe:Drosophila_2:1627741_at:673:385; Interrogation_Position=517; Antisense; GAACAGACGCTGAACGGCACGGATT
>probe:Drosophila_2:1627741_at:497:151; Interrogation_Position=59; Antisense; ACATTTTCCTGGCATTATCCCTATG
>probe:Drosophila_2:1627741_at:526:15; Interrogation_Position=72; Antisense; ATTATCCCTATGGTTCCTGATCGAG
>probe:Drosophila_2:1627741_at:523:41; Interrogation_Position=91; Antisense; ATCGAGGCTCATCCCGTCGAAGGAA

Paste this into a BLAST search page for me
GGAACACGGTGCAGGAATCCCTATGAACTATTGCTACTTCGTTGCTGACGTTTGCTATCAGGACAAGCGCACCTCCACCTCACGAGTTTGCCTGGATAGTGAGGAAATGCGCGTTCTGGCCCATCGGGTGATAACCGCTTCTACTGGAACGAAATATCGCCGGATTCGACTCCACTCAACTACTCCAACTGGGCGGTGGAAAATGGGCCGCAATTGCCTGATCCTACCCGAGCGGTCGATATCTGCGAACGAACAGACGCTGAACGGCACGGATTACATTTTCCTGGCATTATCCCTATGATTATCCCTATGGTTCCTGATCGAGATCGAGGCTCATCCCGTCGAAGGAA

Full Affymetrix probeset data:

Annotations for 1627741_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime