FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627743_at:

>probe:Drosophila_2:1627743_at:263:141; Interrogation_Position=1299; Antisense; ACTGGAGCCCAGTGCAGTTATGCTT
>probe:Drosophila_2:1627743_at:224:705; Interrogation_Position=1316; Antisense; TTATGCTTGGCCACATGGAACCGCA
>probe:Drosophila_2:1627743_at:235:657; Interrogation_Position=1358; Antisense; TAATGGCTTCCAAGCGACGACGCAT
>probe:Drosophila_2:1627743_at:720:409; Interrogation_Position=1373; Antisense; GACGACGCATGCAGCTCTATGATGT
>probe:Drosophila_2:1627743_at:52:707; Interrogation_Position=1402; Antisense; TTACCTGATGCACCCACTGATGAAA
>probe:Drosophila_2:1627743_at:652:209; Interrogation_Position=1457; Antisense; AAGATAAACAACAGCCCGTGGGTGG
>probe:Drosophila_2:1627743_at:643:663; Interrogation_Position=1553; Antisense; TAAATAATCCGCTAATCCGCCTTGG
>probe:Drosophila_2:1627743_at:602:9; Interrogation_Position=1579; Antisense; ATTCCGACCTTGACTGGCGAAAAGC
>probe:Drosophila_2:1627743_at:467:577; Interrogation_Position=1593; Antisense; TGGCGAAAAGCACCAGGCCGGATTC
>probe:Drosophila_2:1627743_at:36:319; Interrogation_Position=1609; Antisense; GCCGGATTCCATCTCCAAAATCAAG
>probe:Drosophila_2:1627743_at:448:371; Interrogation_Position=1639; Antisense; GAAGGGAAAACTCGCCATTCTGCTG
>probe:Drosophila_2:1627743_at:578:719; Interrogation_Position=1698; Antisense; TTCCCTCTTCATCGGCAATTATTTG
>probe:Drosophila_2:1627743_at:348:77; Interrogation_Position=1736; Antisense; AGGAGTACATTTCCGGTGCCATTCG
>probe:Drosophila_2:1627743_at:45:23; Interrogation_Position=1789; Antisense; ATATCGGACGCCCATATATGTACAT

Paste this into a BLAST search page for me
ACTGGAGCCCAGTGCAGTTATGCTTTTATGCTTGGCCACATGGAACCGCATAATGGCTTCCAAGCGACGACGCATGACGACGCATGCAGCTCTATGATGTTTACCTGATGCACCCACTGATGAAAAAGATAAACAACAGCCCGTGGGTGGTAAATAATCCGCTAATCCGCCTTGGATTCCGACCTTGACTGGCGAAAAGCTGGCGAAAAGCACCAGGCCGGATTCGCCGGATTCCATCTCCAAAATCAAGGAAGGGAAAACTCGCCATTCTGCTGTTCCCTCTTCATCGGCAATTATTTGAGGAGTACATTTCCGGTGCCATTCGATATCGGACGCCCATATATGTACAT

Full Affymetrix probeset data:

Annotations for 1627743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720