FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627744_at:

>probe:Drosophila_2:1627744_at:367:491; Interrogation_Position=294; Antisense; TGCCAGAGTCGGAGTTCGTCGGAAA
>probe:Drosophila_2:1627744_at:52:723; Interrogation_Position=321; Antisense; TTGCGCCACGCAATGAGCAGAATCC
>probe:Drosophila_2:1627744_at:304:451; Interrogation_Position=410; Antisense; GATCGACGTGATCTGCGCAAGCTAA
>probe:Drosophila_2:1627744_at:196:641; Interrogation_Position=421; Antisense; TCTGCGCAAGCTAACCTACACGGAG
>probe:Drosophila_2:1627744_at:520:673; Interrogation_Position=459; Antisense; TAGCCCTATGGCATCTGTCCCAGAA
>probe:Drosophila_2:1627744_at:280:41; Interrogation_Position=471; Antisense; ATCTGTCCCAGAATCGCAATGTTTA
>probe:Drosophila_2:1627744_at:564:477; Interrogation_Position=491; Antisense; GTTTACAATGCCAAAGGACCGGAGG
>probe:Drosophila_2:1627744_at:613:321; Interrogation_Position=520; Antisense; GCCCAATCAGGCCATCGATGAGCGT
>probe:Drosophila_2:1627744_at:420:169; Interrogation_Position=647; Antisense; AAAGGCTAGTAGTACGCTCCACGGA
>probe:Drosophila_2:1627744_at:201:519; Interrogation_Position=679; Antisense; GTGGGATGACCCATGCAGATATACA
>probe:Drosophila_2:1627744_at:4:23; Interrogation_Position=717; Antisense; ATATGATATTCTCCGACCTGACTTT
>probe:Drosophila_2:1627744_at:542:279; Interrogation_Position=727; Antisense; CTCCGACCTGACTTTCTTTAGAACA
>probe:Drosophila_2:1627744_at:71:77; Interrogation_Position=757; Antisense; AGGAGCATTGTAATTCCAGCAGCAA
>probe:Drosophila_2:1627744_at:656:479; Interrogation_Position=797; Antisense; GTTTGCCTCATTTTTAGACTCGTAT

Paste this into a BLAST search page for me
TGCCAGAGTCGGAGTTCGTCGGAAATTGCGCCACGCAATGAGCAGAATCCGATCGACGTGATCTGCGCAAGCTAATCTGCGCAAGCTAACCTACACGGAGTAGCCCTATGGCATCTGTCCCAGAAATCTGTCCCAGAATCGCAATGTTTAGTTTACAATGCCAAAGGACCGGAGGGCCCAATCAGGCCATCGATGAGCGTAAAGGCTAGTAGTACGCTCCACGGAGTGGGATGACCCATGCAGATATACAATATGATATTCTCCGACCTGACTTTCTCCGACCTGACTTTCTTTAGAACAAGGAGCATTGTAATTCCAGCAGCAAGTTTGCCTCATTTTTAGACTCGTAT

Full Affymetrix probeset data:

Annotations for 1627744_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720