Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627746_at:

>probe:Drosophila_2:1627746_at:207:361; Interrogation_Position=2526; Antisense; GCAAGTGCGATGACGGTTACATTTT
>probe:Drosophila_2:1627746_at:110:469; Interrogation_Position=2568; Antisense; GTTGCCAGCTTGACAAGGAGCTACT
>probe:Drosophila_2:1627746_at:724:381; Interrogation_Position=2617; Antisense; GAACTGCCGAAATGGAACCTGCGTC
>probe:Drosophila_2:1627746_at:239:725; Interrogation_Position=2702; Antisense; TTGATCTGTCTTCCGATTTGCGAAC
>probe:Drosophila_2:1627746_at:657:19; Interrogation_Position=2717; Antisense; ATTTGCGAACCCGAGTGCCTCAATG
>probe:Drosophila_2:1627746_at:241:653; Interrogation_Position=2736; Antisense; TCAATGGGCTCTGCGAATTTCCGGG
>probe:Drosophila_2:1627746_at:37:243; Interrogation_Position=2751; Antisense; AATTTCCGGGTTCTTGTGTCTGCTG
>probe:Drosophila_2:1627746_at:291:515; Interrogation_Position=2766; Antisense; GTGTCTGCTGGGATGGCCATGAAAA
>probe:Drosophila_2:1627746_at:164:31; Interrogation_Position=2819; Antisense; ATAACGATTGTTTCTATGGCCTTCA
>probe:Drosophila_2:1627746_at:715:713; Interrogation_Position=2830; Antisense; TTCTATGGCCTTCATCTTGGCAATA
>probe:Drosophila_2:1627746_at:546:203; Interrogation_Position=2857; Antisense; AACCACCATGCTGATTATTTATATA
>probe:Drosophila_2:1627746_at:188:561; Interrogation_Position=2886; Antisense; GGAAACGCTCATATCACGTGGACAA
>probe:Drosophila_2:1627746_at:139:467; Interrogation_Position=2930; Antisense; GTATATTTCTCTCCCAATAAGGTTG
>probe:Drosophila_2:1627746_at:430:657; Interrogation_Position=2947; Antisense; TAAGGTTGATATCATTCGAGCCTGA

Paste this into a BLAST search page for me
GCAAGTGCGATGACGGTTACATTTTGTTGCCAGCTTGACAAGGAGCTACTGAACTGCCGAAATGGAACCTGCGTCTTGATCTGTCTTCCGATTTGCGAACATTTGCGAACCCGAGTGCCTCAATGTCAATGGGCTCTGCGAATTTCCGGGAATTTCCGGGTTCTTGTGTCTGCTGGTGTCTGCTGGGATGGCCATGAAAAATAACGATTGTTTCTATGGCCTTCATTCTATGGCCTTCATCTTGGCAATAAACCACCATGCTGATTATTTATATAGGAAACGCTCATATCACGTGGACAAGTATATTTCTCTCCCAATAAGGTTGTAAGGTTGATATCATTCGAGCCTGA

Full Affymetrix probeset data:

Annotations for 1627746_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime