Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627747_s_at:

>probe:Drosophila_2:1627747_s_at:522:177; Interrogation_Position=103; Antisense; AAACTATCACTTCCGGTCCATATAC
>probe:Drosophila_2:1627747_s_at:265:669; Interrogation_Position=125; Antisense; TACGGACTTGTCCAAAGCGCATAGC
>probe:Drosophila_2:1627747_s_at:29:27; Interrogation_Position=145; Antisense; ATAGCGCCCCAAGTCACTGAAGATC
>probe:Drosophila_2:1627747_s_at:704:473; Interrogation_Position=202; Antisense; GTTTTTAGTAATGCTGGTCGGGCCA
>probe:Drosophila_2:1627747_s_at:247:501; Interrogation_Position=218; Antisense; GTCGGGCCAAGAGGAAGTCTACTAT
>probe:Drosophila_2:1627747_s_at:49:669; Interrogation_Position=22; Antisense; TACTTGGGCATGATGCTCCATTTGG
>probe:Drosophila_2:1627747_s_at:518:3; Interrogation_Position=268; Antisense; ATTGGCGAAGCCCTGACAACACAAA
>probe:Drosophila_2:1627747_s_at:534:523; Interrogation_Position=303; Antisense; GGGAGCTTCCGCAAAGAACGACTTC
>probe:Drosophila_2:1627747_s_at:572:381; Interrogation_Position=318; Antisense; GAACGACTTCGATGGCGATTCATCC
>probe:Drosophila_2:1627747_s_at:260:463; Interrogation_Position=334; Antisense; GATTCATCCGACTATGATTTGACCA
>probe:Drosophila_2:1627747_s_at:511:717; Interrogation_Position=352; Antisense; TTGACCAAGGACAAGGAATCTTCTG
>probe:Drosophila_2:1627747_s_at:320:337; Interrogation_Position=36; Antisense; GCTCCATTTGGAGGGATGTGGCAAC
>probe:Drosophila_2:1627747_s_at:338:253; Interrogation_Position=60; Antisense; CAAGCAGCGTTTCCAGTGCGAATTT
>probe:Drosophila_2:1627747_s_at:252:87; Interrogation_Position=74; Antisense; AGTGCGAATTTTGCCAGCGCTCCTA

Paste this into a BLAST search page for me
AAACTATCACTTCCGGTCCATATACTACGGACTTGTCCAAAGCGCATAGCATAGCGCCCCAAGTCACTGAAGATCGTTTTTAGTAATGCTGGTCGGGCCAGTCGGGCCAAGAGGAAGTCTACTATTACTTGGGCATGATGCTCCATTTGGATTGGCGAAGCCCTGACAACACAAAGGGAGCTTCCGCAAAGAACGACTTCGAACGACTTCGATGGCGATTCATCCGATTCATCCGACTATGATTTGACCATTGACCAAGGACAAGGAATCTTCTGGCTCCATTTGGAGGGATGTGGCAACCAAGCAGCGTTTCCAGTGCGAATTTAGTGCGAATTTTGCCAGCGCTCCTA

Full Affymetrix probeset data:

Annotations for 1627747_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime