FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627748_at:

>probe:Drosophila_2:1627748_at:267:245; Interrogation_Position=103; Antisense; AATTTCTCTTCATGCATTGCTGGTC
>probe:Drosophila_2:1627748_at:93:171; Interrogation_Position=138; Antisense; AAAGGATTGCACGTTCTTCACGCGC
>probe:Drosophila_2:1627748_at:280:97; Interrogation_Position=167; Antisense; AGATCCTGCGGGTTCACAAGCGATT
>probe:Drosophila_2:1627748_at:555:535; Interrogation_Position=213; Antisense; GGTGCCTCGCCAAATGACCGAAGGT
>probe:Drosophila_2:1627748_at:518:223; Interrogation_Position=233; Antisense; AAGGTCAGGCCTCCAGTGTTAAGGT
>probe:Drosophila_2:1627748_at:132:81; Interrogation_Position=254; Antisense; AGGTGCCCTGCGAATGCATTGAGAA
>probe:Drosophila_2:1627748_at:384:215; Interrogation_Position=277; Antisense; AAGATGCCCGAGTTGCGCGAGGCCT
>probe:Drosophila_2:1627748_at:76:441; Interrogation_Position=310; Antisense; GATGGCCAGGGCAATTTATCCTTTG
>probe:Drosophila_2:1627748_at:506:295; Interrogation_Position=366; Antisense; CGAGCAGGCGCCGAGGGACATTAAA
>probe:Drosophila_2:1627748_at:645:603; Interrogation_Position=414; Antisense; TGATTTCGATCAGGACGGCTTCATC
>probe:Drosophila_2:1627748_at:354:553; Interrogation_Position=498; Antisense; GGAGCACCAGCAGATTGCCGACAAG
>probe:Drosophila_2:1627748_at:667:93; Interrogation_Position=572; Antisense; AGTTCGAGCACGTTATACTCCGGGC
>probe:Drosophila_2:1627748_at:307:645; Interrogation_Position=606; Antisense; TCTATCCACCTTTCACATCAGAATA
>probe:Drosophila_2:1627748_at:358:373; Interrogation_Position=82; Antisense; GAAGTTCACTTCCACACAGCTAATT

Paste this into a BLAST search page for me
AATTTCTCTTCATGCATTGCTGGTCAAAGGATTGCACGTTCTTCACGCGCAGATCCTGCGGGTTCACAAGCGATTGGTGCCTCGCCAAATGACCGAAGGTAAGGTCAGGCCTCCAGTGTTAAGGTAGGTGCCCTGCGAATGCATTGAGAAAAGATGCCCGAGTTGCGCGAGGCCTGATGGCCAGGGCAATTTATCCTTTGCGAGCAGGCGCCGAGGGACATTAAATGATTTCGATCAGGACGGCTTCATCGGAGCACCAGCAGATTGCCGACAAGAGTTCGAGCACGTTATACTCCGGGCTCTATCCACCTTTCACATCAGAATAGAAGTTCACTTCCACACAGCTAATT

Full Affymetrix probeset data:

Annotations for 1627748_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720