FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627749_at:

>probe:Drosophila_2:1627749_at:529:63; Interrogation_Position=1058; Antisense; ATGTGGGCACCACGGAAGGCATCAC
>probe:Drosophila_2:1627749_at:102:227; Interrogation_Position=1073; Antisense; AAGGCATCACCCAGGTGGGCAAGTA
>probe:Drosophila_2:1627749_at:203:487; Interrogation_Position=1095; Antisense; GTACGGAGCGATCGTAGCCTACCGA
>probe:Drosophila_2:1627749_at:454:301; Interrogation_Position=1130; Antisense; CCCTGCTGGACTTTGAGTTTCACAA
>probe:Drosophila_2:1627749_at:383:429; Interrogation_Position=1144; Antisense; GAGTTTCACAAGAGCATTTGCCAGC
>probe:Drosophila_2:1627749_at:574:137; Interrogation_Position=1235; Antisense; ACGATGAGACGTGCCTGATTCACCA
>probe:Drosophila_2:1627749_at:271:463; Interrogation_Position=1251; Antisense; GATTCACCAGGAGTATCTGCTCGAT
>probe:Drosophila_2:1627749_at:312:685; Interrogation_Position=1264; Antisense; TATCTGCTCGATGCGGACAAGACGG
>probe:Drosophila_2:1627749_at:104:77; Interrogation_Position=1304; Antisense; AGGAGCACAACTGCGAGATCGTCGA
>probe:Drosophila_2:1627749_at:257:97; Interrogation_Position=1319; Antisense; AGATCGTCGACTACCATCGCTTCGA
>probe:Drosophila_2:1627749_at:431:425; Interrogation_Position=1349; Antisense; GAGAGCACACGGAACGCAGCCTGGA
>probe:Drosophila_2:1627749_at:343:589; Interrogation_Position=1370; Antisense; TGGAGGCGATCATTCGCTCGCAGCA
>probe:Drosophila_2:1627749_at:541:265; Interrogation_Position=1396; Antisense; CAGAGCAGCAATTAACTAGCCATTA
>probe:Drosophila_2:1627749_at:294:287; Interrogation_Position=988; Antisense; CGGCGCGCATTGTGCTTTAAGGCTA

Paste this into a BLAST search page for me
ATGTGGGCACCACGGAAGGCATCACAAGGCATCACCCAGGTGGGCAAGTAGTACGGAGCGATCGTAGCCTACCGACCCTGCTGGACTTTGAGTTTCACAAGAGTTTCACAAGAGCATTTGCCAGCACGATGAGACGTGCCTGATTCACCAGATTCACCAGGAGTATCTGCTCGATTATCTGCTCGATGCGGACAAGACGGAGGAGCACAACTGCGAGATCGTCGAAGATCGTCGACTACCATCGCTTCGAGAGAGCACACGGAACGCAGCCTGGATGGAGGCGATCATTCGCTCGCAGCACAGAGCAGCAATTAACTAGCCATTACGGCGCGCATTGTGCTTTAAGGCTA

Full Affymetrix probeset data:

Annotations for 1627749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720