FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627755_at:

>probe:Drosophila_2:1627755_at:70:449; Interrogation_Position=1019; Antisense; GATCGGTTTTGAGCCTGGTGCGCCA
>probe:Drosophila_2:1627755_at:486:239; Interrogation_Position=1175; Antisense; AATCATCGTCCCATTATGTCTTCAG
>probe:Drosophila_2:1627755_at:403:681; Interrogation_Position=1189; Antisense; TATGTCTTCAGCACACAGTCAACGC
>probe:Drosophila_2:1627755_at:20:129; Interrogation_Position=647; Antisense; ACCTGCGCGTTCTCAAGGCAAGGAA
>probe:Drosophila_2:1627755_at:306:201; Interrogation_Position=673; Antisense; AACCGGATCAGTGAGCTGGGCCTGC
>probe:Drosophila_2:1627755_at:319:617; Interrogation_Position=695; Antisense; TGCTCTCCTTCTTGGGAATGTGCCC
>probe:Drosophila_2:1627755_at:647:267; Interrogation_Position=742; Antisense; CAGGGCAATCCCGTGTGTCGTTTAC
>probe:Drosophila_2:1627755_at:356:597; Interrogation_Position=795; Antisense; TGTGCCCACGTTGCAACTGTTGGAT
>probe:Drosophila_2:1627755_at:412:193; Interrogation_Position=832; Antisense; AACGGTGAACCTGCTCCGGTGGAGA
>probe:Drosophila_2:1627755_at:317:65; Interrogation_Position=856; Antisense; ATGGAGGAGGCCACATCCCCGGCAT
>probe:Drosophila_2:1627755_at:180:45; Interrogation_Position=870; Antisense; ATCCCCGGCATCAAGTGATCTGGAG
>probe:Drosophila_2:1627755_at:245:451; Interrogation_Position=886; Antisense; GATCTGGAGTCTGGCTCCGAGACGA
>probe:Drosophila_2:1627755_at:282:425; Interrogation_Position=904; Antisense; GAGACGACTGCACAACGGCCGAACA
>probe:Drosophila_2:1627755_at:270:719; Interrogation_Position=950; Antisense; TTCCTATCGCCTTGAATGCTGCCAT

Paste this into a BLAST search page for me
GATCGGTTTTGAGCCTGGTGCGCCAAATCATCGTCCCATTATGTCTTCAGTATGTCTTCAGCACACAGTCAACGCACCTGCGCGTTCTCAAGGCAAGGAAAACCGGATCAGTGAGCTGGGCCTGCTGCTCTCCTTCTTGGGAATGTGCCCCAGGGCAATCCCGTGTGTCGTTTACTGTGCCCACGTTGCAACTGTTGGATAACGGTGAACCTGCTCCGGTGGAGAATGGAGGAGGCCACATCCCCGGCATATCCCCGGCATCAAGTGATCTGGAGGATCTGGAGTCTGGCTCCGAGACGAGAGACGACTGCACAACGGCCGAACATTCCTATCGCCTTGAATGCTGCCAT

Full Affymetrix probeset data:

Annotations for 1627755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720