FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627758_at:

>probe:Drosophila_2:1627758_at:656:87; Interrogation_Position=1010; Antisense; AGTCGGGCTCCGATTACTATCAGCA
>probe:Drosophila_2:1627758_at:120:149; Interrogation_Position=1037; Antisense; ACTATAACCCGTATGCTGGCACAAA
>probe:Drosophila_2:1627758_at:285:41; Interrogation_Position=1067; Antisense; ATCGGCATCCTTGGTCTTATGGCAG
>probe:Drosophila_2:1627758_at:36:705; Interrogation_Position=1083; Antisense; TTATGGCAGGCAGCGTTACTCATCC
>probe:Drosophila_2:1627758_at:176:129; Interrogation_Position=1110; Antisense; ACCGTGGTCTTCAGCTTCGTTGGGC
>probe:Drosophila_2:1627758_at:724:289; Interrogation_Position=1142; Antisense; CGGGCGTGAGCTCTTACTTGGATAA
>probe:Drosophila_2:1627758_at:709:409; Interrogation_Position=1307; Antisense; GACGCAGCGATGCTTTCTATACTCG
>probe:Drosophila_2:1627758_at:505:643; Interrogation_Position=1322; Antisense; TCTATACTCGCACACGCATTAATTG
>probe:Drosophila_2:1627758_at:452:551; Interrogation_Position=792; Antisense; GGAGATGGCCAATAAGCCGCCCCAA
>probe:Drosophila_2:1627758_at:317:227; Interrogation_Position=825; Antisense; AATGGAGTACCAGTCGAACCCTCAG
>probe:Drosophila_2:1627758_at:412:381; Interrogation_Position=840; Antisense; GAACCCTCAGCAAAATCATCACGAT
>probe:Drosophila_2:1627758_at:273:641; Interrogation_Position=867; Antisense; TCGGCCCCACAACGCGAATGATGAT
>probe:Drosophila_2:1627758_at:704:51; Interrogation_Position=890; Antisense; ATGCTTATAATTACGGGCAGCGCCG
>probe:Drosophila_2:1627758_at:134:441; Interrogation_Position=943; Antisense; GATGGCGGCGATTTCTATCCTAATC

Paste this into a BLAST search page for me
AGTCGGGCTCCGATTACTATCAGCAACTATAACCCGTATGCTGGCACAAAATCGGCATCCTTGGTCTTATGGCAGTTATGGCAGGCAGCGTTACTCATCCACCGTGGTCTTCAGCTTCGTTGGGCCGGGCGTGAGCTCTTACTTGGATAAGACGCAGCGATGCTTTCTATACTCGTCTATACTCGCACACGCATTAATTGGGAGATGGCCAATAAGCCGCCCCAAAATGGAGTACCAGTCGAACCCTCAGGAACCCTCAGCAAAATCATCACGATTCGGCCCCACAACGCGAATGATGATATGCTTATAATTACGGGCAGCGCCGGATGGCGGCGATTTCTATCCTAATC

Full Affymetrix probeset data:

Annotations for 1627758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720