FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627759_at:

>probe:Drosophila_2:1627759_at:415:389; Interrogation_Position=2246; Antisense; GAAAACACCTCGCTTGGAGCTGCAA
>probe:Drosophila_2:1627759_at:95:335; Interrogation_Position=2264; Antisense; GCTGCAATAAATTCCGGTCGCTATC
>probe:Drosophila_2:1627759_at:50:247; Interrogation_Position=2273; Antisense; AATTCCGGTCGCTATCAAGACGAGC
>probe:Drosophila_2:1627759_at:168:493; Interrogation_Position=2303; Antisense; GTAACGTTTCAAAGCCAGACGCGCT
>probe:Drosophila_2:1627759_at:184:103; Interrogation_Position=2319; Antisense; AGACGCGCTAAGATTGCTAATTCCA
>probe:Drosophila_2:1627759_at:595:721; Interrogation_Position=2332; Antisense; TTGCTAATTCCAAAGCTTCGACCAG
>probe:Drosophila_2:1627759_at:410:53; Interrogation_Position=2503; Antisense; ATGCAGTAGCTCCATCGTGGTCTAC
>probe:Drosophila_2:1627759_at:667:289; Interrogation_Position=2518; Antisense; CGTGGTCTACTAAGATCGATTCAAC
>probe:Drosophila_2:1627759_at:168:13; Interrogation_Position=2536; Antisense; ATTCAACCTAGTCCGATGCAATCGA
>probe:Drosophila_2:1627759_at:182:367; Interrogation_Position=2559; Antisense; GAATCTCTCGAAAGTGCGGCACAAA
>probe:Drosophila_2:1627759_at:179:467; Interrogation_Position=2589; Antisense; GTTGTGTATATTGCCGGCTCGACGA
>probe:Drosophila_2:1627759_at:13:573; Interrogation_Position=2604; Antisense; GGCTCGACGACATATCGCCATATCA
>probe:Drosophila_2:1627759_at:271:245; Interrogation_Position=2690; Antisense; AATTATCTATAGCTCATCCCATCGT
>probe:Drosophila_2:1627759_at:161:339; Interrogation_Position=2701; Antisense; GCTCATCCCATCGTAACTAATCTAA

Paste this into a BLAST search page for me
GAAAACACCTCGCTTGGAGCTGCAAGCTGCAATAAATTCCGGTCGCTATCAATTCCGGTCGCTATCAAGACGAGCGTAACGTTTCAAAGCCAGACGCGCTAGACGCGCTAAGATTGCTAATTCCATTGCTAATTCCAAAGCTTCGACCAGATGCAGTAGCTCCATCGTGGTCTACCGTGGTCTACTAAGATCGATTCAACATTCAACCTAGTCCGATGCAATCGAGAATCTCTCGAAAGTGCGGCACAAAGTTGTGTATATTGCCGGCTCGACGAGGCTCGACGACATATCGCCATATCAAATTATCTATAGCTCATCCCATCGTGCTCATCCCATCGTAACTAATCTAA

Full Affymetrix probeset data:

Annotations for 1627759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720