Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627761_at:

>probe:Drosophila_2:1627761_at:29:235; Interrogation_Position=13561; Antisense; AATCCCTTGCCAGATATAACCGAAG
>probe:Drosophila_2:1627761_at:64:463; Interrogation_Position=13606; Antisense; GATTCGTCGAGCTTACACAGCAACG
>probe:Drosophila_2:1627761_at:188:457; Interrogation_Position=13630; Antisense; GATAGCAACGAGTCCAAGTCGAAGA
>probe:Drosophila_2:1627761_at:582:173; Interrogation_Position=13654; Antisense; AAAGCCTTTTTCGTGCACAGGGAAG
>probe:Drosophila_2:1627761_at:103:43; Interrogation_Position=13691; Antisense; ATCCGACGAGGGATATAGCCGCGTT
>probe:Drosophila_2:1627761_at:433:351; Interrogation_Position=13753; Antisense; GCAGAGAGCTGCTTGGAGCCGTTTA
>probe:Drosophila_2:1627761_at:545:553; Interrogation_Position=13767; Antisense; GGAGCCGTTTATGTTGCCAAGATCA
>probe:Drosophila_2:1627761_at:386:311; Interrogation_Position=13800; Antisense; GCCACTTTCAAGACTGAGTTCTTTT
>probe:Drosophila_2:1627761_at:95:211; Interrogation_Position=13875; Antisense; AAGACATCCTGATTCGTATTTACCG
>probe:Drosophila_2:1627761_at:334:17; Interrogation_Position=13892; Antisense; ATTTACCGACGATGCATTTTCCAAG
>probe:Drosophila_2:1627761_at:356:445; Interrogation_Position=13902; Antisense; GATGCATTTTCCAAGTGAGACCGAT
>probe:Drosophila_2:1627761_at:602:27; Interrogation_Position=14010; Antisense; ATACCTATTTCCATGCACTGTCGGA
>probe:Drosophila_2:1627761_at:493:583; Interrogation_Position=14040; Antisense; TGGATCCAACAGCAACATTTCGGTT
>probe:Drosophila_2:1627761_at:147:191; Interrogation_Position=14053; Antisense; AACATTTCGGTTCGACTGTGTGAAA

Paste this into a BLAST search page for me
AATCCCTTGCCAGATATAACCGAAGGATTCGTCGAGCTTACACAGCAACGGATAGCAACGAGTCCAAGTCGAAGAAAAGCCTTTTTCGTGCACAGGGAAGATCCGACGAGGGATATAGCCGCGTTGCAGAGAGCTGCTTGGAGCCGTTTAGGAGCCGTTTATGTTGCCAAGATCAGCCACTTTCAAGACTGAGTTCTTTTAAGACATCCTGATTCGTATTTACCGATTTACCGACGATGCATTTTCCAAGGATGCATTTTCCAAGTGAGACCGATATACCTATTTCCATGCACTGTCGGATGGATCCAACAGCAACATTTCGGTTAACATTTCGGTTCGACTGTGTGAAA

Full Affymetrix probeset data:

Annotations for 1627761_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime