Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627764_at:

>probe:Drosophila_2:1627764_at:680:725; Interrogation_Position=2109; Antisense; TTGTGCTGCTGTAGATCGTTGCCGC
>probe:Drosophila_2:1627764_at:152:151; Interrogation_Position=2141; Antisense; ACATAACCCTGTTGCTGTGCTAGCT
>probe:Drosophila_2:1627764_at:281:509; Interrogation_Position=2157; Antisense; GTGCTAGCTGTGTTATTTGCTCATT
>probe:Drosophila_2:1627764_at:49:689; Interrogation_Position=2184; Antisense; TATTTGATTTAGTTGCCAGCCGCTG
>probe:Drosophila_2:1627764_at:340:187; Interrogation_Position=2237; Antisense; AACAGACCCGTATCTCAAACACAAA
>probe:Drosophila_2:1627764_at:706:487; Interrogation_Position=2271; Antisense; GTACCTTTACGCCTACGCATATAGT
>probe:Drosophila_2:1627764_at:193:607; Interrogation_Position=2329; Antisense; TGATGTCCACGTTAATCTCTCTTTT
>probe:Drosophila_2:1627764_at:25:655; Interrogation_Position=2341; Antisense; TAATCTCTCTTTTGTTCGACCTGTC
>probe:Drosophila_2:1627764_at:455:599; Interrogation_Position=2362; Antisense; TGTCGTCTCGCATTCTGCCAAAGTT
>probe:Drosophila_2:1627764_at:308:311; Interrogation_Position=2378; Antisense; GCCAAAGTTTTTCAGCTATTTCCAT
>probe:Drosophila_2:1627764_at:308:687; Interrogation_Position=2394; Antisense; TATTTCCATGTTCGAGCAGCCCGAT
>probe:Drosophila_2:1627764_at:76:263; Interrogation_Position=2410; Antisense; CAGCCCGATCTGTTTATATGTGTTA
>probe:Drosophila_2:1627764_at:463:535; Interrogation_Position=2511; Antisense; GGTGCCACAATTGTCACTATTCTTT
>probe:Drosophila_2:1627764_at:474:481; Interrogation_Position=2539; Antisense; GTATTTCATGTAGCGCTTAGTTCTA

Paste this into a BLAST search page for me
TTGTGCTGCTGTAGATCGTTGCCGCACATAACCCTGTTGCTGTGCTAGCTGTGCTAGCTGTGTTATTTGCTCATTTATTTGATTTAGTTGCCAGCCGCTGAACAGACCCGTATCTCAAACACAAAGTACCTTTACGCCTACGCATATAGTTGATGTCCACGTTAATCTCTCTTTTTAATCTCTCTTTTGTTCGACCTGTCTGTCGTCTCGCATTCTGCCAAAGTTGCCAAAGTTTTTCAGCTATTTCCATTATTTCCATGTTCGAGCAGCCCGATCAGCCCGATCTGTTTATATGTGTTAGGTGCCACAATTGTCACTATTCTTTGTATTTCATGTAGCGCTTAGTTCTA

Full Affymetrix probeset data:

Annotations for 1627764_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime