FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627768_at:

>probe:Drosophila_2:1627768_at:111:387; Interrogation_Position=106; Antisense; GAACAACCAAATCTTGTGGCCGGAC
>probe:Drosophila_2:1627768_at:523:397; Interrogation_Position=128; Antisense; GACACCCACCTGCATTGAAGGCTGG
>probe:Drosophila_2:1627768_at:220:7; Interrogation_Position=141; Antisense; ATTGAAGGCTGGTGGCATGCGAATT
>probe:Drosophila_2:1627768_at:314:5; Interrogation_Position=163; Antisense; ATTGTGCAGCACAAAGCGCCGACGG
>probe:Drosophila_2:1627768_at:240:201; Interrogation_Position=191; Antisense; AACGCGCGCCCAAGGATGCAGAGGA
>probe:Drosophila_2:1627768_at:85:601; Interrogation_Position=217; Antisense; TGTACTGGACTGACACAACCCATTG
>probe:Drosophila_2:1627768_at:517:7; Interrogation_Position=238; Antisense; ATTGCCGTGAACTCCGGCTCTGTGA
>probe:Drosophila_2:1627768_at:453:291; Interrogation_Position=273; Antisense; CGTCAAGGGCAACACGGACTTTACG
>probe:Drosophila_2:1627768_at:161:49; Interrogation_Position=367; Antisense; ATCCAGCAGCCACGGAAGTGATGCG
>probe:Drosophila_2:1627768_at:533:83; Interrogation_Position=383; Antisense; AGTGATGCGTACTCGGGCGGAATAA
>probe:Drosophila_2:1627768_at:52:397; Interrogation_Position=443; Antisense; GAAATTCTATGAGTCCTCTCAATGG
>probe:Drosophila_2:1627768_at:500:535; Interrogation_Position=46; Antisense; GGTGCCGCGCATTTATTTACAACTA
>probe:Drosophila_2:1627768_at:613:315; Interrogation_Position=478; Antisense; GCCTTTGAATGCGATATTTACTCTT
>probe:Drosophila_2:1627768_at:134:695; Interrogation_Position=519; Antisense; TTTGCCACTGCATTCCATAAATTAA

Paste this into a BLAST search page for me
GAACAACCAAATCTTGTGGCCGGACGACACCCACCTGCATTGAAGGCTGGATTGAAGGCTGGTGGCATGCGAATTATTGTGCAGCACAAAGCGCCGACGGAACGCGCGCCCAAGGATGCAGAGGATGTACTGGACTGACACAACCCATTGATTGCCGTGAACTCCGGCTCTGTGACGTCAAGGGCAACACGGACTTTACGATCCAGCAGCCACGGAAGTGATGCGAGTGATGCGTACTCGGGCGGAATAAGAAATTCTATGAGTCCTCTCAATGGGGTGCCGCGCATTTATTTACAACTAGCCTTTGAATGCGATATTTACTCTTTTTGCCACTGCATTCCATAAATTAA

Full Affymetrix probeset data:

Annotations for 1627768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720