FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627771_at:

>probe:Drosophila_2:1627771_at:263:175; Interrogation_Position=434; Antisense; AAACCGTCTGTGTACCGTCTTGTGC
>probe:Drosophila_2:1627771_at:289:727; Interrogation_Position=453; Antisense; TTGTGCCTCCGAATTTCTTGGATTG
>probe:Drosophila_2:1627771_at:645:541; Interrogation_Position=472; Antisense; GGATTGGATGCCACCTGTAGCAACA
>probe:Drosophila_2:1627771_at:3:399; Interrogation_Position=537; Antisense; GACAACTCCTAGTGCTGCGCAGAAA
>probe:Drosophila_2:1627771_at:335:459; Interrogation_Position=565; Antisense; GATTTGTGCAATGCTGGCGAGCCTA
>probe:Drosophila_2:1627771_at:331:365; Interrogation_Position=617; Antisense; GAATAACCGATGACTCCACGTGCAA
>probe:Drosophila_2:1627771_at:55:189; Interrogation_Position=640; Antisense; AACAGCTACCTGTACTGCCAGAAAT
>probe:Drosophila_2:1627771_at:421:593; Interrogation_Position=676; Antisense; TGGGTTGCCCTCTATATGACTTGCG
>probe:Drosophila_2:1627771_at:542:691; Interrogation_Position=718; Antisense; TTTGATTCAACCACCAGCTCATGTG
>probe:Drosophila_2:1627771_at:112:119; Interrogation_Position=733; Antisense; AGCTCATGTGTGACAACCAGGCCGA
>probe:Drosophila_2:1627771_at:285:647; Interrogation_Position=799; Antisense; TCATCGACTGCTTCTTCAACTGAGT
>probe:Drosophila_2:1627771_at:280:431; Interrogation_Position=832; Antisense; GAGTCTTCATCAACGACTGCTTCAT
>probe:Drosophila_2:1627771_at:425:197; Interrogation_Position=873; Antisense; AACGGAATCTACACCAACGACTGCG
>probe:Drosophila_2:1627771_at:443:135; Interrogation_Position=961; Antisense; ACGCAGTCTTCTTCTACGGAATCAT

Paste this into a BLAST search page for me
AAACCGTCTGTGTACCGTCTTGTGCTTGTGCCTCCGAATTTCTTGGATTGGGATTGGATGCCACCTGTAGCAACAGACAACTCCTAGTGCTGCGCAGAAAGATTTGTGCAATGCTGGCGAGCCTAGAATAACCGATGACTCCACGTGCAAAACAGCTACCTGTACTGCCAGAAATTGGGTTGCCCTCTATATGACTTGCGTTTGATTCAACCACCAGCTCATGTGAGCTCATGTGTGACAACCAGGCCGATCATCGACTGCTTCTTCAACTGAGTGAGTCTTCATCAACGACTGCTTCATAACGGAATCTACACCAACGACTGCGACGCAGTCTTCTTCTACGGAATCAT

Full Affymetrix probeset data:

Annotations for 1627771_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720