Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627774_a_at:

>probe:Drosophila_2:1627774_a_at:358:203; Interrogation_Position=199; Antisense; AACCAGGTGCTGTTCGACAAGGCCA
>probe:Drosophila_2:1627774_a_at:374:227; Interrogation_Position=217; Antisense; AAGGCCACCTACGAGAAGCTGTACA
>probe:Drosophila_2:1627774_a_at:565:203; Interrogation_Position=232; Antisense; AAGCTGTACAAGGAAGTGCCCGCCT
>probe:Drosophila_2:1627774_a_at:364:373; Interrogation_Position=244; Antisense; GAAGTGCCCGCCTACAAGCTGATCA
>probe:Drosophila_2:1627774_a_at:577:533; Interrogation_Position=276; Antisense; GGTGGTCTCCGAGCGTCTGAAGATC
>probe:Drosophila_2:1627774_a_at:56:455; Interrogation_Position=351; Antisense; GATCAAGCAGGTCGTGCAGCATCAT
>probe:Drosophila_2:1627774_a_at:4:619; Interrogation_Position=365; Antisense; TGCAGCATCATTCCCAGGTCATCTA
>probe:Drosophila_2:1627774_a_at:270:37; Interrogation_Position=385; Antisense; ATCTACACACGTGCCACCAAGGGTG
>probe:Drosophila_2:1627774_a_at:235:369; Interrogation_Position=423; Antisense; GAATGTTTTACCTTTTGCCCATCTC
>probe:Drosophila_2:1627774_a_at:490:353; Interrogation_Position=462; Antisense; GCACTCGCCTTACAATAGAACTCTG
>probe:Drosophila_2:1627774_a_at:422:107; Interrogation_Position=478; Antisense; AGAACTCTGTATCGATAGCACTACG
>probe:Drosophila_2:1627774_a_at:704:445; Interrogation_Position=502; Antisense; GATGCCGCTGTGTGTGTAACGTTGA
>probe:Drosophila_2:1627774_a_at:485:443; Interrogation_Position=552; Antisense; GATGTATCACTGAGCGCTGGTTTCA
>probe:Drosophila_2:1627774_a_at:3:591; Interrogation_Position=569; Antisense; TGGTTTCAAGATGTCGAGCCGGAGT

Paste this into a BLAST search page for me
AACCAGGTGCTGTTCGACAAGGCCAAAGGCCACCTACGAGAAGCTGTACAAAGCTGTACAAGGAAGTGCCCGCCTGAAGTGCCCGCCTACAAGCTGATCAGGTGGTCTCCGAGCGTCTGAAGATCGATCAAGCAGGTCGTGCAGCATCATTGCAGCATCATTCCCAGGTCATCTAATCTACACACGTGCCACCAAGGGTGGAATGTTTTACCTTTTGCCCATCTCGCACTCGCCTTACAATAGAACTCTGAGAACTCTGTATCGATAGCACTACGGATGCCGCTGTGTGTGTAACGTTGAGATGTATCACTGAGCGCTGGTTTCATGGTTTCAAGATGTCGAGCCGGAGT

Full Affymetrix probeset data:

Annotations for 1627774_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime