Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627776_at:

>probe:Drosophila_2:1627776_at:23:565; Interrogation_Position=4545; Antisense; GGCAAGACGATTTCGGCGGCAGACC
>probe:Drosophila_2:1627776_at:204:351; Interrogation_Position=4570; Antisense; GCAGCAAGAATTTCGTGCCGCGTCG
>probe:Drosophila_2:1627776_at:344:109; Interrogation_Position=4597; Antisense; AGAAGCATGCGCAACTGGCCACTAC
>probe:Drosophila_2:1627776_at:96:209; Interrogation_Position=4664; Antisense; AAGCAATCTCGAGGCAGTGCAGCTC
>probe:Drosophila_2:1627776_at:289:109; Interrogation_Position=4735; Antisense; AGCAAACGATCGTCTTGGGTCCGCC
>probe:Drosophila_2:1627776_at:143:249; Interrogation_Position=4809; Antisense; CACTCGGAGGCCTACATTAAGTACA
>probe:Drosophila_2:1627776_at:216:711; Interrogation_Position=4825; Antisense; TTAAGTACATCGAGAGCCTGCAGAC
>probe:Drosophila_2:1627776_at:72:101; Interrogation_Position=4846; Antisense; AGACGGGCAGCCATCTGAACGTGGT
>probe:Drosophila_2:1627776_at:433:519; Interrogation_Position=4866; Antisense; GTGGTCACCTGCAACAACAATTGGC
>probe:Drosophila_2:1627776_at:424:161; Interrogation_Position=4882; Antisense; ACAATTGGCGGCGTGCACTGACCCA
>probe:Drosophila_2:1627776_at:727:451; Interrogation_Position=4955; Antisense; GATCGGACCGAATCTGCGCGACCAG
>probe:Drosophila_2:1627776_at:451:359; Interrogation_Position=4981; Antisense; GCAACGTGGTGCAGGCACTGTGCCA
>probe:Drosophila_2:1627776_at:572:239; Interrogation_Position=5039; Antisense; AATACGGCGCAGTTGCAACTAGCCC
>probe:Drosophila_2:1627776_at:153:205; Interrogation_Position=5077; Antisense; AAGCCCAAAGCTTTTTGAGTTCCAT

Paste this into a BLAST search page for me
GGCAAGACGATTTCGGCGGCAGACCGCAGCAAGAATTTCGTGCCGCGTCGAGAAGCATGCGCAACTGGCCACTACAAGCAATCTCGAGGCAGTGCAGCTCAGCAAACGATCGTCTTGGGTCCGCCCACTCGGAGGCCTACATTAAGTACATTAAGTACATCGAGAGCCTGCAGACAGACGGGCAGCCATCTGAACGTGGTGTGGTCACCTGCAACAACAATTGGCACAATTGGCGGCGTGCACTGACCCAGATCGGACCGAATCTGCGCGACCAGGCAACGTGGTGCAGGCACTGTGCCAAATACGGCGCAGTTGCAACTAGCCCAAGCCCAAAGCTTTTTGAGTTCCAT

Full Affymetrix probeset data:

Annotations for 1627776_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime