FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627781_at:

>probe:Drosophila_2:1627781_at:614:95; Interrogation_Position=1011; Antisense; AGATTAGACGGTTTCGTGGCAGCGA
>probe:Drosophila_2:1627781_at:578:339; Interrogation_Position=702; Antisense; GCTATGACTTTTGCAAACGCTTTCT
>probe:Drosophila_2:1627781_at:285:177; Interrogation_Position=716; Antisense; AAACGCTTTCTGATTGCCGAGTTCG
>probe:Drosophila_2:1627781_at:128:627; Interrogation_Position=730; Antisense; TGCCGAGTTCGATCTGGTGGATAAC
>probe:Drosophila_2:1627781_at:188:423; Interrogation_Position=756; Antisense; GAGAAGTGCAGTTCGTAGCCGCCAT
>probe:Drosophila_2:1627781_at:286:121; Interrogation_Position=793; Antisense; AGCGGATGCCATTCTGAGCTTGCCA
>probe:Drosophila_2:1627781_at:212:117; Interrogation_Position=809; Antisense; AGCTTGCCAGCGGACGTGGTCAAGT
>probe:Drosophila_2:1627781_at:372:219; Interrogation_Position=830; Antisense; AAGTCCCGGATCATGAATCAGCCAA
>probe:Drosophila_2:1627781_at:40:203; Interrogation_Position=853; Antisense; AACCGATGAGCAGGGACGCGGCATT
>probe:Drosophila_2:1627781_at:550:133; Interrogation_Position=868; Antisense; ACGCGGCATTCATTACAAGGGCTCC
>probe:Drosophila_2:1627781_at:164:223; Interrogation_Position=884; Antisense; AAGGGCTCCCTGGATTGCTTAAGTA
>probe:Drosophila_2:1627781_at:263:549; Interrogation_Position=922; Antisense; GGAGGGCTTTTTGGCCATGTACAAG
>probe:Drosophila_2:1627781_at:674:19; Interrogation_Position=958; Antisense; ATATTGGATGCGTGTCGGACCTGCC
>probe:Drosophila_2:1627781_at:142:515; Interrogation_Position=989; Antisense; GTGTTCTGGATGACCTTCGAGCAGA

Paste this into a BLAST search page for me
AGATTAGACGGTTTCGTGGCAGCGAGCTATGACTTTTGCAAACGCTTTCTAAACGCTTTCTGATTGCCGAGTTCGTGCCGAGTTCGATCTGGTGGATAACGAGAAGTGCAGTTCGTAGCCGCCATAGCGGATGCCATTCTGAGCTTGCCAAGCTTGCCAGCGGACGTGGTCAAGTAAGTCCCGGATCATGAATCAGCCAAAACCGATGAGCAGGGACGCGGCATTACGCGGCATTCATTACAAGGGCTCCAAGGGCTCCCTGGATTGCTTAAGTAGGAGGGCTTTTTGGCCATGTACAAGATATTGGATGCGTGTCGGACCTGCCGTGTTCTGGATGACCTTCGAGCAGA

Full Affymetrix probeset data:

Annotations for 1627781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720