FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627782_at:

>probe:Drosophila_2:1627782_at:129:185; Interrogation_Position=111; Antisense; AAAATGCCTGTTTTGGAGCACATCA
>probe:Drosophila_2:1627782_at:101:693; Interrogation_Position=122; Antisense; TTTGGAGCACATCAAAGCCATGGCA
>probe:Drosophila_2:1627782_at:595:173; Interrogation_Position=135; Antisense; AAAGCCATGGCAGAGACTCCGACTC
>probe:Drosophila_2:1627782_at:365:285; Interrogation_Position=163; Antisense; CTGAGAACAGCCCTGCACCGGCAGA
>probe:Drosophila_2:1627782_at:608:615; Interrogation_Position=176; Antisense; TGCACCGGCAGACGAGAATGCTCCG
>probe:Drosophila_2:1627782_at:34:269; Interrogation_Position=204; Antisense; CAGGCAGTCCGGGAACTGACGCAGA
>probe:Drosophila_2:1627782_at:314:527; Interrogation_Position=214; Antisense; GGGAACTGACGCAGACCGACCATCT
>probe:Drosophila_2:1627782_at:176:515; Interrogation_Position=24; Antisense; GTGTACCCTACACTTAGCCAAGTTT
>probe:Drosophila_2:1627782_at:101:277; Interrogation_Position=249; Antisense; CTTCTCAAATCGCTCCTGGAAAACA
>probe:Drosophila_2:1627782_at:178:561; Interrogation_Position=266; Antisense; GGAAAACATGCAGGCCACCGAGGTT
>probe:Drosophila_2:1627782_at:687:309; Interrogation_Position=280; Antisense; CCACCGAGGTTCTGGCGCAGGAGAA
>probe:Drosophila_2:1627782_at:192:345; Interrogation_Position=296; Antisense; GCAGGAGAACGGGAACGGCTCCAAC
>probe:Drosophila_2:1627782_at:234:127; Interrogation_Position=39; Antisense; AGCCAAGTTTCCAAGTGCACGAGTC
>probe:Drosophila_2:1627782_at:542:495; Interrogation_Position=61; Antisense; GTCACCCAGCGGACTGTGTGTCATA

Paste this into a BLAST search page for me
AAAATGCCTGTTTTGGAGCACATCATTTGGAGCACATCAAAGCCATGGCAAAAGCCATGGCAGAGACTCCGACTCCTGAGAACAGCCCTGCACCGGCAGATGCACCGGCAGACGAGAATGCTCCGCAGGCAGTCCGGGAACTGACGCAGAGGGAACTGACGCAGACCGACCATCTGTGTACCCTACACTTAGCCAAGTTTCTTCTCAAATCGCTCCTGGAAAACAGGAAAACATGCAGGCCACCGAGGTTCCACCGAGGTTCTGGCGCAGGAGAAGCAGGAGAACGGGAACGGCTCCAACAGCCAAGTTTCCAAGTGCACGAGTCGTCACCCAGCGGACTGTGTGTCATA

Full Affymetrix probeset data:

Annotations for 1627782_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720