FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627783_at:

>probe:Drosophila_2:1627783_at:432:193; Interrogation_Position=1269; Antisense; AACTCAAGTCGGATTCTCACAAGAA
>probe:Drosophila_2:1627783_at:468:107; Interrogation_Position=1305; Antisense; AGAACAAGCGCGTCCGGACAATCTT
>probe:Drosophila_2:1627783_at:370:471; Interrogation_Position=1363; Antisense; GTTCGAGCGCCAGCAGTACATGGTC
>probe:Drosophila_2:1627783_at:239:565; Interrogation_Position=1408; Antisense; GGCACACACCCTAAAGTTAACGGAG
>probe:Drosophila_2:1627783_at:489:383; Interrogation_Position=1490; Antisense; GAACTGACACAACAACGGCTGGCAT
>probe:Drosophila_2:1627783_at:548:267; Interrogation_Position=1536; Antisense; CAGGTACATCGTTATTGGGCAATCA
>probe:Drosophila_2:1627783_at:730:593; Interrogation_Position=1551; Antisense; TGGGCAATCAAGTATCCGTGTCGGC
>probe:Drosophila_2:1627783_at:689:515; Interrogation_Position=1592; Antisense; GTGTCCACGGAACGCACAAACGGAT
>probe:Drosophila_2:1627783_at:22:437; Interrogation_Position=1655; Antisense; GAGGATAGCAAGCACTCGCTGTCGC
>probe:Drosophila_2:1627783_at:389:13; Interrogation_Position=1690; Antisense; ATTACCGCCGTTGAGTCGAGCGCAG
>probe:Drosophila_2:1627783_at:3:89; Interrogation_Position=1703; Antisense; AGTCGAGCGCAGTCCGAGTCGGATT
>probe:Drosophila_2:1627783_at:410:431; Interrogation_Position=1718; Antisense; GAGTCGGATTTGTCCATCTGTAACG
>probe:Drosophila_2:1627783_at:728:489; Interrogation_Position=1737; Antisense; GTAACGATTCCCTGGACGGCGACAG
>probe:Drosophila_2:1627783_at:443:435; Interrogation_Position=1778; Antisense; GAGGAGGCCTAAAAACCACGCCAGT

Paste this into a BLAST search page for me
AACTCAAGTCGGATTCTCACAAGAAAGAACAAGCGCGTCCGGACAATCTTGTTCGAGCGCCAGCAGTACATGGTCGGCACACACCCTAAAGTTAACGGAGGAACTGACACAACAACGGCTGGCATCAGGTACATCGTTATTGGGCAATCATGGGCAATCAAGTATCCGTGTCGGCGTGTCCACGGAACGCACAAACGGATGAGGATAGCAAGCACTCGCTGTCGCATTACCGCCGTTGAGTCGAGCGCAGAGTCGAGCGCAGTCCGAGTCGGATTGAGTCGGATTTGTCCATCTGTAACGGTAACGATTCCCTGGACGGCGACAGGAGGAGGCCTAAAAACCACGCCAGT

Full Affymetrix probeset data:

Annotations for 1627783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720