FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627785_at:

>probe:Drosophila_2:1627785_at:690:589; Interrogation_Position=398; Antisense; TGGTTTGGAGCTATGTGATCTGCCT
>probe:Drosophila_2:1627785_at:681:47; Interrogation_Position=427; Antisense; ATCCTGCTGTGCCTGCAGATTTATA
>probe:Drosophila_2:1627785_at:148:461; Interrogation_Position=444; Antisense; GATTTATATTATCGCGGCAGCCCAC
>probe:Drosophila_2:1627785_at:154:211; Interrogation_Position=493; Antisense; AAGAAGGATTTCCTGGCCACCTGGG
>probe:Drosophila_2:1627785_at:290:313; Interrogation_Position=508; Antisense; GCCACCTGGGCTGATCAAAGGACCA
>probe:Drosophila_2:1627785_at:705:123; Interrogation_Position=539; Antisense; AGCGCATATCGCTCCTTGAGCAAAA
>probe:Drosophila_2:1627785_at:247:183; Interrogation_Position=560; Antisense; AAAAGTACTCCTGCTGCGGCCAGTT
>probe:Drosophila_2:1627785_at:206:531; Interrogation_Position=615; Antisense; GGGTATACCCTTGAGCTGCTACAAG
>probe:Drosophila_2:1627785_at:321:75; Interrogation_Position=644; Antisense; AGGAGCGGCGCGAGTACAGCCTCTT
>probe:Drosophila_2:1627785_at:502:557; Interrogation_Position=724; Antisense; GGACTCATCATCAAGTGGCTGCTGC
>probe:Drosophila_2:1627785_at:695:149; Interrogation_Position=785; Antisense; ACTTGGGCATCACGGTGCGCAATAA
>probe:Drosophila_2:1627785_at:672:7; Interrogation_Position=810; Antisense; ATTGCGGCGCGAAAGATTCTAACAG
>probe:Drosophila_2:1627785_at:59:189; Interrogation_Position=830; Antisense; AACAGGTCGCTTGGAATCATCGAAA
>probe:Drosophila_2:1627785_at:116:467; Interrogation_Position=861; Antisense; GTTGGCAACGCATAATCCGATATCT

Paste this into a BLAST search page for me
TGGTTTGGAGCTATGTGATCTGCCTATCCTGCTGTGCCTGCAGATTTATAGATTTATATTATCGCGGCAGCCCACAAGAAGGATTTCCTGGCCACCTGGGGCCACCTGGGCTGATCAAAGGACCAAGCGCATATCGCTCCTTGAGCAAAAAAAAGTACTCCTGCTGCGGCCAGTTGGGTATACCCTTGAGCTGCTACAAGAGGAGCGGCGCGAGTACAGCCTCTTGGACTCATCATCAAGTGGCTGCTGCACTTGGGCATCACGGTGCGCAATAAATTGCGGCGCGAAAGATTCTAACAGAACAGGTCGCTTGGAATCATCGAAAGTTGGCAACGCATAATCCGATATCT

Full Affymetrix probeset data:

Annotations for 1627785_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720