FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627788_at:

>probe:Drosophila_2:1627788_at:169:527; Interrogation_Position=1522; Antisense; GGGACAGCATAACATGCCCATCGAA
>probe:Drosophila_2:1627788_at:683:49; Interrogation_Position=1535; Antisense; ATGCCCATCGAATCGTTAGACGTGA
>probe:Drosophila_2:1627788_at:256:235; Interrogation_Position=1559; Antisense; AATGCCAGCGGTGAGCTCATCGCAT
>probe:Drosophila_2:1627788_at:726:35; Interrogation_Position=1582; Antisense; ATCATCCTCGCACAACAACGACGTG
>probe:Drosophila_2:1627788_at:48:255; Interrogation_Position=1597; Antisense; CAACGACGTGCGATTCTGGAATGTA
>probe:Drosophila_2:1627788_at:227:225; Interrogation_Position=1676; Antisense; AAGGAGCAGCGTCACAATCTGCCCT
>probe:Drosophila_2:1627788_at:667:319; Interrogation_Position=1696; Antisense; GCCCTCCTCAAAATGCAGCAATGCA
>probe:Drosophila_2:1627788_at:253:701; Interrogation_Position=1730; Antisense; TTTTCCGACTTGACCAAAGAGAACG
>probe:Drosophila_2:1627788_at:122:57; Interrogation_Position=1767; Antisense; ATGATCCGGGCGCTGGACCCAGTAA
>probe:Drosophila_2:1627788_at:456:333; Interrogation_Position=1778; Antisense; GCTGGACCCAGTAATATGGCCTAGA
>probe:Drosophila_2:1627788_at:391:605; Interrogation_Position=1846; Antisense; TGAGGCGATTCTACAAACACTTCTG
>probe:Drosophila_2:1627788_at:65:453; Interrogation_Position=1968; Antisense; GATAGAACCTCTTTGAAACCGTCAA
>probe:Drosophila_2:1627788_at:356:493; Interrogation_Position=1988; Antisense; GTCAAAACGTAGTAGCTACCCCAAT
>probe:Drosophila_2:1627788_at:634:115; Interrogation_Position=2001; Antisense; AGCTACCCCAATCCCTAATATGTTG

Paste this into a BLAST search page for me
GGGACAGCATAACATGCCCATCGAAATGCCCATCGAATCGTTAGACGTGAAATGCCAGCGGTGAGCTCATCGCATATCATCCTCGCACAACAACGACGTGCAACGACGTGCGATTCTGGAATGTAAAGGAGCAGCGTCACAATCTGCCCTGCCCTCCTCAAAATGCAGCAATGCATTTTCCGACTTGACCAAAGAGAACGATGATCCGGGCGCTGGACCCAGTAAGCTGGACCCAGTAATATGGCCTAGATGAGGCGATTCTACAAACACTTCTGGATAGAACCTCTTTGAAACCGTCAAGTCAAAACGTAGTAGCTACCCCAATAGCTACCCCAATCCCTAATATGTTG

Full Affymetrix probeset data:

Annotations for 1627788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720