FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627789_at:

>probe:Drosophila_2:1627789_at:699:317; Interrogation_Position=1008; Antisense; GCCGGGTGCCAAGTAGATAATCCAT
>probe:Drosophila_2:1627789_at:66:455; Interrogation_Position=1023; Antisense; GATAATCCATCCCTTTTGAAACCTT
>probe:Drosophila_2:1627789_at:616:677; Interrogation_Position=1070; Antisense; TAGAGCTCTCAATCGTGCAACGTAT
>probe:Drosophila_2:1627789_at:86:13; Interrogation_Position=1169; Antisense; ATTATGCAAGTTTTCTAAGCCTATC
>probe:Drosophila_2:1627789_at:607:659; Interrogation_Position=1184; Antisense; TAAGCCTATCTTTTGTAACTGCAAT
>probe:Drosophila_2:1627789_at:353:79; Interrogation_Position=647; Antisense; AGGATTCCGACGATGACTCCGAAGC
>probe:Drosophila_2:1627789_at:67:523; Interrogation_Position=697; Antisense; GTGGCCTCACTCATCGAAATCGAGA
>probe:Drosophila_2:1627789_at:110:131; Interrogation_Position=728; Antisense; ACCGGGTGACCAAGAAGGCCACACA
>probe:Drosophila_2:1627789_at:110:573; Interrogation_Position=796; Antisense; GGCGGTAATCCCAAGCCGGAGCTTT
>probe:Drosophila_2:1627789_at:160:389; Interrogation_Position=844; Antisense; GAAAAGCAGAGAGCGCGCCAGCGTT
>probe:Drosophila_2:1627789_at:182:193; Interrogation_Position=875; Antisense; AACTCCATGCTGCTGGTAAAACCAC
>probe:Drosophila_2:1627789_at:664:655; Interrogation_Position=906; Antisense; TAAGGCCGATCTGGCCAGATTGGCT
>probe:Drosophila_2:1627789_at:421:95; Interrogation_Position=922; Antisense; AGATTGGCTTTGATCCGGCAGCAGC
>probe:Drosophila_2:1627789_at:600:225; Interrogation_Position=982; Antisense; AAGGCAGCCGATGTGGGCACCAAAA

Paste this into a BLAST search page for me
GCCGGGTGCCAAGTAGATAATCCATGATAATCCATCCCTTTTGAAACCTTTAGAGCTCTCAATCGTGCAACGTATATTATGCAAGTTTTCTAAGCCTATCTAAGCCTATCTTTTGTAACTGCAATAGGATTCCGACGATGACTCCGAAGCGTGGCCTCACTCATCGAAATCGAGAACCGGGTGACCAAGAAGGCCACACAGGCGGTAATCCCAAGCCGGAGCTTTGAAAAGCAGAGAGCGCGCCAGCGTTAACTCCATGCTGCTGGTAAAACCACTAAGGCCGATCTGGCCAGATTGGCTAGATTGGCTTTGATCCGGCAGCAGCAAGGCAGCCGATGTGGGCACCAAAA

Full Affymetrix probeset data:

Annotations for 1627789_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720