FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627791_at:

>probe:Drosophila_2:1627791_at:657:351; Interrogation_Position=127; Antisense; GCAGCCAACATTTTATCTGGCCAAG
>probe:Drosophila_2:1627791_at:346:693; Interrogation_Position=166; Antisense; TTTGATGGGCCAACAACCCAGCAGG
>probe:Drosophila_2:1627791_at:438:525; Interrogation_Position=189; Antisense; GGGCAAACAAAAATACCTCATCGTG
>probe:Drosophila_2:1627791_at:300:603; Interrogation_Position=20; Antisense; TGATTCCGCCGCTGGCGAAAGACGA
>probe:Drosophila_2:1627791_at:550:673; Interrogation_Position=202; Antisense; TACCTCATCGTGGAGATCAACAGCC
>probe:Drosophila_2:1627791_at:367:127; Interrogation_Position=223; Antisense; AGCCATGTGGCACTGTTCCGGGATA
>probe:Drosophila_2:1627791_at:34:531; Interrogation_Position=242; Antisense; GGGATATGCTGATACACGTCGGCCA
>probe:Drosophila_2:1627791_at:107:29; Interrogation_Position=253; Antisense; ATACACGTCGGCCAGGCCAAGGATT
>probe:Drosophila_2:1627791_at:355:79; Interrogation_Position=272; Antisense; AGGATTGCCCCGAGCTCCGGGAGAA
>probe:Drosophila_2:1627791_at:584:109; Interrogation_Position=293; Antisense; AGAAGATCCGCAAGTTGCGTCGCAC
>probe:Drosophila_2:1627791_at:578:97; Interrogation_Position=347; Antisense; AGATCCTGATGCCTCAAGTCAAGAG
>probe:Drosophila_2:1627791_at:536:573; Interrogation_Position=46; Antisense; GGCGTCGGCCAAGGAATTAGGTCTC
>probe:Drosophila_2:1627791_at:514:705; Interrogation_Position=62; Antisense; TTAGGTCTCGATTGCACGACTCATT
>probe:Drosophila_2:1627791_at:335:281; Interrogation_Position=93; Antisense; CTCCATTTCGGCAATGGGCCGTAAA

Paste this into a BLAST search page for me
GCAGCCAACATTTTATCTGGCCAAGTTTGATGGGCCAACAACCCAGCAGGGGGCAAACAAAAATACCTCATCGTGTGATTCCGCCGCTGGCGAAAGACGATACCTCATCGTGGAGATCAACAGCCAGCCATGTGGCACTGTTCCGGGATAGGGATATGCTGATACACGTCGGCCAATACACGTCGGCCAGGCCAAGGATTAGGATTGCCCCGAGCTCCGGGAGAAAGAAGATCCGCAAGTTGCGTCGCACAGATCCTGATGCCTCAAGTCAAGAGGGCGTCGGCCAAGGAATTAGGTCTCTTAGGTCTCGATTGCACGACTCATTCTCCATTTCGGCAATGGGCCGTAAA

Full Affymetrix probeset data:

Annotations for 1627791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720