Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627794_a_at:

>probe:Drosophila_2:1627794_a_at:20:551; Interrogation_Position=479; Antisense; GGAGTTTATCGAGGCCTACACCTAC
>probe:Drosophila_2:1627794_a_at:154:91; Interrogation_Position=508; Antisense; AGTACCTGTGCCACGAGGATGCTGA
>probe:Drosophila_2:1627794_a_at:204:417; Interrogation_Position=551; Antisense; GAGCGTTTCAGATTGGCAGGCCATT
>probe:Drosophila_2:1627794_a_at:722:273; Interrogation_Position=572; Antisense; CATTCAGGCGGTGATGCAGTACGTC
>probe:Drosophila_2:1627794_a_at:353:325; Interrogation_Position=634; Antisense; GCGAAGATGTTCAGGCTATAGCTCA
>probe:Drosophila_2:1627794_a_at:79:727; Interrogation_Position=661; Antisense; TTGAGAGCCCAAAGAAGTTCCAGTT
>probe:Drosophila_2:1627794_a_at:530:485; Interrogation_Position=690; Antisense; GTAGACCCCACGGAATATATACTTG
>probe:Drosophila_2:1627794_a_at:694:727; Interrogation_Position=712; Antisense; TTGGACTTTCGGATCTTACTGGTGA
>probe:Drosophila_2:1627794_a_at:236:709; Interrogation_Position=727; Antisense; TTACTGGTGAACTGATGCGCCGCTG
>probe:Drosophila_2:1627794_a_at:273:51; Interrogation_Position=741; Antisense; ATGCGCCGCTGCATAAATTCGCTAG
>probe:Drosophila_2:1627794_a_at:450:103; Interrogation_Position=779; Antisense; AGACACCTGTTTGGACACCTGCAAG
>probe:Drosophila_2:1627794_a_at:257:305; Interrogation_Position=806; Antisense; CCTGCAGCATTTCTACAGCGGGTTG
>probe:Drosophila_2:1627794_a_at:426:207; Interrogation_Position=867; Antisense; AAGCAGAGCGTTCTTAAGGCCGAGA
>probe:Drosophila_2:1627794_a_at:135:435; Interrogation_Position=978; Antisense; GAGGGCTTCTACTAATGGAACTCCA

Paste this into a BLAST search page for me
GGAGTTTATCGAGGCCTACACCTACAGTACCTGTGCCACGAGGATGCTGAGAGCGTTTCAGATTGGCAGGCCATTCATTCAGGCGGTGATGCAGTACGTCGCGAAGATGTTCAGGCTATAGCTCATTGAGAGCCCAAAGAAGTTCCAGTTGTAGACCCCACGGAATATATACTTGTTGGACTTTCGGATCTTACTGGTGATTACTGGTGAACTGATGCGCCGCTGATGCGCCGCTGCATAAATTCGCTAGAGACACCTGTTTGGACACCTGCAAGCCTGCAGCATTTCTACAGCGGGTTGAAGCAGAGCGTTCTTAAGGCCGAGAGAGGGCTTCTACTAATGGAACTCCA

Full Affymetrix probeset data:

Annotations for 1627794_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime