Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627797_at:

>probe:Drosophila_2:1627797_at:404:567; Interrogation_Position=2825; Antisense; GGCGTGAAGCCTACCAGTTGGGCCA
>probe:Drosophila_2:1627797_at:315:121; Interrogation_Position=2885; Antisense; AGCGGAGTTTGTCCTTCATCCAACA
>probe:Drosophila_2:1627797_at:339:359; Interrogation_Position=2915; Antisense; GCAACTGCTGCGATGGCCAAATGTA
>probe:Drosophila_2:1627797_at:419:555; Interrogation_Position=3003; Antisense; GGACCGTCAGCCATTGATATGCACC
>probe:Drosophila_2:1627797_at:78:457; Interrogation_Position=3018; Antisense; GATATGCACCTGCAGCAGTCCAAAT
>probe:Drosophila_2:1627797_at:303:563; Interrogation_Position=3044; Antisense; GGAATCCGGTCACCTATGGAACTCA
>probe:Drosophila_2:1627797_at:292:123; Interrogation_Position=3127; Antisense; AGCCGCAGTGTTCCAGAGGGTTTAT
>probe:Drosophila_2:1627797_at:30:435; Interrogation_Position=3142; Antisense; GAGGGTTTATCCACGATGTCGCAGC
>probe:Drosophila_2:1627797_at:535:347; Interrogation_Position=3165; Antisense; GCAGTGTAACTGTCGTCAGGGTCCT
>probe:Drosophila_2:1627797_at:123:511; Interrogation_Position=3295; Antisense; GGGCCGGGAAACTCAGCATTGCGAA
>probe:Drosophila_2:1627797_at:527:389; Interrogation_Position=3317; Antisense; GAAACAATCCACAATGCCGGCTGAA
>probe:Drosophila_2:1627797_at:106:573; Interrogation_Position=3335; Antisense; GGCTGAAAAGATCCCAATCCCTATG
>probe:Drosophila_2:1627797_at:529:133; Interrogation_Position=3363; Antisense; ACCCAATGCCGTTCAGTTCGTGGAG
>probe:Drosophila_2:1627797_at:82:553; Interrogation_Position=3384; Antisense; GGAGCAAATCACCACGTCCGTGTAG

Paste this into a BLAST search page for me
GGCGTGAAGCCTACCAGTTGGGCCAAGCGGAGTTTGTCCTTCATCCAACAGCAACTGCTGCGATGGCCAAATGTAGGACCGTCAGCCATTGATATGCACCGATATGCACCTGCAGCAGTCCAAATGGAATCCGGTCACCTATGGAACTCAAGCCGCAGTGTTCCAGAGGGTTTATGAGGGTTTATCCACGATGTCGCAGCGCAGTGTAACTGTCGTCAGGGTCCTGGGCCGGGAAACTCAGCATTGCGAAGAAACAATCCACAATGCCGGCTGAAGGCTGAAAAGATCCCAATCCCTATGACCCAATGCCGTTCAGTTCGTGGAGGGAGCAAATCACCACGTCCGTGTAG

Full Affymetrix probeset data:

Annotations for 1627797_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime