FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627798_at:

>probe:Drosophila_2:1627798_at:127:349; Interrogation_Position=417; Antisense; GCAGACCCAAGCTCGTGAGACAGGT
>probe:Drosophila_2:1627798_at:651:423; Interrogation_Position=433; Antisense; GAGACAGGTATTTGTCCCGTGCGCC
>probe:Drosophila_2:1627798_at:615:319; Interrogation_Position=455; Antisense; GCCGCGAGCTGTACTCACAATGTTT
>probe:Drosophila_2:1627798_at:175:97; Interrogation_Position=485; Antisense; AGATCATTCGCCAGGTCACCATTAA
>probe:Drosophila_2:1627798_at:394:661; Interrogation_Position=507; Antisense; TAACTGTTCAGAGCGTGGCCTGCTA
>probe:Drosophila_2:1627798_at:157:669; Interrogation_Position=530; Antisense; TACTGCTTCGCATCCGCGATGAGAT
>probe:Drosophila_2:1627798_at:88:451; Interrogation_Position=552; Antisense; GATCGCCATGTCAATGGAGGCCTAT
>probe:Drosophila_2:1627798_at:160:151; Interrogation_Position=580; Antisense; ACATTGTACTGCAGTTCCGTAGCCT
>probe:Drosophila_2:1627798_at:15:719; Interrogation_Position=594; Antisense; TTCCGTAGCCTTTGGCATGCGCAAG
>probe:Drosophila_2:1627798_at:385:167; Interrogation_Position=644; Antisense; AAATGCTTCGTGATCGGGTCAAGAC
>probe:Drosophila_2:1627798_at:60:657; Interrogation_Position=744; Antisense; TAATGCTGAGCTGAGGGCCTCTGAA
>probe:Drosophila_2:1627798_at:339:377; Interrogation_Position=801; Antisense; GAAGAAGACCAACGCTCAGCTGAAG
>probe:Drosophila_2:1627798_at:621:569; Interrogation_Position=838; Antisense; GGCATAACCGCACCCAAGAAGTAAA
>probe:Drosophila_2:1627798_at:214:519; Interrogation_Position=879; Antisense; GTGGTCTATGCGTTTTTGATTTGTC

Paste this into a BLAST search page for me
GCAGACCCAAGCTCGTGAGACAGGTGAGACAGGTATTTGTCCCGTGCGCCGCCGCGAGCTGTACTCACAATGTTTAGATCATTCGCCAGGTCACCATTAATAACTGTTCAGAGCGTGGCCTGCTATACTGCTTCGCATCCGCGATGAGATGATCGCCATGTCAATGGAGGCCTATACATTGTACTGCAGTTCCGTAGCCTTTCCGTAGCCTTTGGCATGCGCAAGAAATGCTTCGTGATCGGGTCAAGACTAATGCTGAGCTGAGGGCCTCTGAAGAAGAAGACCAACGCTCAGCTGAAGGGCATAACCGCACCCAAGAAGTAAAGTGGTCTATGCGTTTTTGATTTGTC

Full Affymetrix probeset data:

Annotations for 1627798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720