FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627799_at:

>probe:Drosophila_2:1627799_at:145:605; Interrogation_Position=1005; Antisense; TGATCCTCAATATCCTTACCACAAA
>probe:Drosophila_2:1627799_at:515:325; Interrogation_Position=1048; Antisense; GCGTTTAGTGAGTTACCGTGATTTC
>probe:Drosophila_2:1627799_at:36:515; Interrogation_Position=1065; Antisense; GTGATTTCAAACTTTCCATCTGGAA
>probe:Drosophila_2:1627799_at:686:377; Interrogation_Position=1093; Antisense; GAAGCTTGTTGCGTTATCTTGTGCA
>probe:Drosophila_2:1627799_at:404:257; Interrogation_Position=1123; Antisense; CACATTTTTTGTTTCGAGCACGACC
>probe:Drosophila_2:1627799_at:650:419; Interrogation_Position=1138; Antisense; GAGCACGACCTTCCACCAGGAGGAA
>probe:Drosophila_2:1627799_at:363:385; Interrogation_Position=1160; Antisense; GAAAAGAGCTCTGTTACCCGGATAT
>probe:Drosophila_2:1627799_at:521:43; Interrogation_Position=1175; Antisense; ACCCGGATATTTGTACGTAGATGGA
>probe:Drosophila_2:1627799_at:445:55; Interrogation_Position=659; Antisense; ATGAAGAACGACCTGTGCTCCGGAG
>probe:Drosophila_2:1627799_at:427:623; Interrogation_Position=705; Antisense; TGCGCTGCGACTTCTCGGTGCAATG
>probe:Drosophila_2:1627799_at:445:11; Interrogation_Position=803; Antisense; ATTCTATCCACCTTGGTGCATCCGG
>probe:Drosophila_2:1627799_at:725:635; Interrogation_Position=853; Antisense; TCTGCCCGAGCCAGGAGGTAGCCAG
>probe:Drosophila_2:1627799_at:242:447; Interrogation_Position=936; Antisense; GATCCAACAGTCTGGACGAGCCGGA
>probe:Drosophila_2:1627799_at:571:73; Interrogation_Position=990; Antisense; AGGACCCGGCTTGGGTGATCCTCAA

Paste this into a BLAST search page for me
TGATCCTCAATATCCTTACCACAAAGCGTTTAGTGAGTTACCGTGATTTCGTGATTTCAAACTTTCCATCTGGAAGAAGCTTGTTGCGTTATCTTGTGCACACATTTTTTGTTTCGAGCACGACCGAGCACGACCTTCCACCAGGAGGAAGAAAAGAGCTCTGTTACCCGGATATACCCGGATATTTGTACGTAGATGGAATGAAGAACGACCTGTGCTCCGGAGTGCGCTGCGACTTCTCGGTGCAATGATTCTATCCACCTTGGTGCATCCGGTCTGCCCGAGCCAGGAGGTAGCCAGGATCCAACAGTCTGGACGAGCCGGAAGGACCCGGCTTGGGTGATCCTCAA

Full Affymetrix probeset data:

Annotations for 1627799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720